
Twelve years a Bulldog, Mark Richt's breakthrough chance comes Saturday. (AP photo by David Goldman)
Mark Richt apprenticed at Florida State when the Seminoles played for five national championships in eight seasons, and he came to Athens expecting more of the same. “That was the plan coming in,” he said Friday, “but it hasn’t happened yet.”
It could well happen Saturday. If Richt’s team wins the SEC championship game, the plan will have come to fruition. Twelve years Georgia’s coach, Richt has never been so close to playing for the BCS title. Twelve years Georgia’s coach, the path finally is clear.
A coach can never know when, or if, his moment will arrive. Richt had great early success – three division titles and two SEC championships in his first five years – and then he had rather less. We began to wonder if a fine career could ever bring the ultimate validation. Well, it’s there to be seized under the off-white roof of the Georgia Dome, there to be seized in the kind of game Richt has waited all his life to coach.
Beat Alabama, and Georgia will play Notre Dame for the national championship. “I don’t want to minimize the importance of the SEC (title),” said Richt, speaking at a media briefing, “but that (the BCS) does add a lot more juice.”
A program that went years without defeating an opponent of true consequence now gets its shot at the opponent of greatest consequence. Alabama is the gold standard of college football, and Bama is favored by a touchdown. But the feeling of those close to the Tide is that this is Nick Saban’s least imposing team of the past four – two of which have won national championships – and that Georgia is at least a match in talent.
There’s also this: A mighty wind has stationed itself at Georgia’s back. On Oct. 6, the Bulldogs lost at South Carolina 35-7, and no national-champion-to-be has ever lost by 28 points. But every week since has brought nothing but glad tidings to Georgia hearts. Consider:
Over seven giddy weeks, Georgia grew from a puzzling aggregation into a powerful one. Said Richt: “We have a lot of momentum.”
A month ago, the Bulldogs didn’t figure to stand a chance against mighty Bama. Today they’re seen by most neutral observers as a live underdog with a real chance, and even those picking the Tide are doing it largely because of the Tide’s experience in games of such magnitude. But this is a younger Bama team, and true eminence could be a year away.
For Georgia, both gifted and seasoned, a grand opportunity is at hand – an opportunity denied this program since the Bulldogs faced Penn State on Jan. 1, 1983. It was Herschel Walker’s last night as an amateur, and for 30 years Bulldog Nation has waited, not entirely patiently, for another chance at another national title.
For those long-suffering fans, for a coach who once seemed to have run out of ideas, for a team that was routed in its first real test of 2012 … for everyone involved with Georgia football, the moment has arrived. One massive game against one formidable opponent, one Dawg day of deliverance. Georgia 27, Alabama 20.
By Mark Bradley
381 comments Add your comment
delane
November 30th, 2012
4:44 pm
Alabama in a landslide first
bham dawg
November 30th, 2012
4:50 pm
i have a good feeling about this one. no one is giving us a chance. setting up to be something special. go dawgs.
GTT
November 30th, 2012
4:52 pm
Fifth!
Oh sookie sookie now
November 30th, 2012
4:54 pm
Hell yea Mark!! Lets obliterate those snaggle tooth rednecks over there in rama jama bama land!!!!!!!!!!!!!!!!!!!!!!!
mike addington
November 30th, 2012
4:54 pm
If Murray stay’s composed, we win. If not, we don’t. I think it’s as simple as that, but I don have a good feeling and dare I say “Hope” one more time. If they fall aprt in this game, well. . . let’s just Hope that doesn’t happen again.
We (did) Run The East
November 30th, 2012
4:54 pm
All comes crashing down. No NC has ever been routed the way SC routed UGA and end up #1. Oct 6th showed how vunerable Dawgs are. Good D will shut them .
Brian
November 30th, 2012
4:55 pm
Go Dawgs!!!!! Cant’ wait for kickoff!!!
GTT
November 30th, 2012
4:56 pm
I think your predicted score is a pretty good one.
delane
November 30th, 2012
4:57 pm
UGA will self-destruct. Alabama will stop the run. Murrey will fumble and crumble as always.
UGA benefitted by a great schedule and a Florida hiccup. The always overrated Dogs go down.
40-10 Alabama
PRESSURE
November 30th, 2012
4:57 pm
http://thegeorgiasportsreport.blogspot.com/
Oh sookie sookie now
November 30th, 2012
4:58 pm
Nov. 24: The Bulldogs pound Georgia Tech like a kettledrum. Hell yea we did Mark!
Another Mr. Bradley
November 30th, 2012
5:00 pm
Best article you’ve ever written!
Joey
November 30th, 2012
5:01 pm
Mark, from this UGA fan, who made 3 straight trips to New Orleans back in Dooley’s big years, and who made close to 70 trips from south Georgia to Athens from ‘78 on, thanks for some good writing this week about the Bulldogs and their big game tomorrow.
I’ve always called Mark Richt a great man, and a good coach – and have often wished the reverse – but I have written since last winter, “I hope he collects every single bonus in his new contract.”
And right now, there’s nothing more I’d rather see than that.
Good luck Coach Richt and Staff.
Go Dawgs!
Taco Meat
November 30th, 2012
5:01 pm
Dawgs on top!
Jimmy Crack
November 30th, 2012
5:05 pm
Holy Moly!!! His-toh-ree!!
P-U-M-P-E-D-!
Good article Mark!
zamboni_racer
November 30th, 2012
5:06 pm
I would like to see Dogs win this one, Richt deserves it along with the team. But I think it’ll be tough to beat Bama, they will be up for this game and have the experience winning on the national stage.
ROLL TIDE
November 30th, 2012
5:06 pm
Thanks Mark Bradley,
This is great bulletin board material for Alabama. I’m going to go post this on all the Alabama boards right now and email it to Saban!
You’re awesome!
KOOL
November 30th, 2012
5:10 pm
Woof!!
JoeDAWGSFan
November 30th, 2012
5:12 pm
If the Georgia defense that showed up against Florida shows up against ‘Bama, the DAWGS have a real shot at this game. Hopefully Murray will keep his composure and use his receivers to slice and dice ‘Bama’s secondary. Time to feast on some elephant! LET’S GO DAWGS!!!
mike addington
November 30th, 2012
5:13 pm
To your point about Fl ST Mark. think how many NC games FL St would have played had it not been “wide right” or “wide left” vs Miami & others. Wow. Bobby Bowden would have gone down as playing in or winning more NCs than anyone had that not been the case. Should be on his toombstone. what a great coach and guy! I just hope the coach Richt who came from FL State shows up this week and not the one we’ve seen the last few years. Has 2 B the most perplexing situations I’ve seen in all sports.
markie mark
November 30th, 2012
5:13 pm
Delane, show me where Alabama’s schedule was so tough – just as we played none of the power teams of the west, they played none of the power teams from the east…..the schedule crap is….crap
Patched Tire On I-95 in Jacksonville
November 30th, 2012
5:15 pm
Yep the moment is at hand!!!!!!
Weve heard about Dream Team I and II
Weve heard about Knocking on the Door to Greatness
Weve heard about Cutting Edge Football
Well enough of the talking its time show it
I hope the coaches have come up with a great game plan and have the players ready to play
demhairydwags
November 30th, 2012
5:15 pm
Predciting UGA 38-24 SIC EM! FIRE MARK RICHT!
Joey
November 30th, 2012
5:16 pm
ROLL TIDE, how can you possibly do all that where you reside?
Paul Johnson’s hind-end has free Wi-Fi?
NC Dawg
November 30th, 2012
5:18 pm
Great year for Dawgs win or lose. Should be a very interesting game. GoDawgs!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
LakeDawg
November 30th, 2012
5:18 pm
Oh hell yeah!
ARdawg
November 30th, 2012
5:21 pm
Bulletin board material, what a joke. ROLL TIDE if you want real BB material just post on the Bama fan blogs we plan on stealing their trailer axles while they’re in Atlanta
Ronald L. White, JD
November 30th, 2012
5:28 pm
Even though I live in Alabama, I am not opposed to a Georgia victory. Spread the wealth, I say. The winner of this game, will trounce Notre Dame. The luck of the Irish, just ran out.
Ronald L. White, JD
November 30th, 2012
5:29 pm
Excellent job, Mark Bradley!!
sandiegodawg
November 30th, 2012
5:31 pm
Defining moment? I think coming to Christ was his defining moment. This is just football- please keep in perspective ppl whatever the outcome of this game.
BILLY JACK
November 30th, 2012
5:31 pm
BAMA HAD ITS TIME-NOW ITS GEORGIAS TIME-WE HAVE BETTER PLAYERS-NOW LETS PROVE IT-NO REGRETS.
david
November 30th, 2012
5:33 pm
Now thats funny ARdawg! BB material– if anyone needs BB material they should find a new sport. Maybe roll tide is really really scared.
JD Hater
November 30th, 2012
5:33 pm
Probably no better an attorney than prognosticator – don’t give up the day job of eating your young.
Sunbury Ga dawg
November 30th, 2012
5:35 pm
Everyone take notice because you didn’t listen last week. Dawgs early and often, Dawgs are going to show the world what they can do in less that 18 hours. Get ready
Go Dawgs!
Dumpster fire
November 30th, 2012
5:37 pm
Tech fans, please go home, we have bigger fish to fry……pass the hot sauce please!
Silver Fox
November 30th, 2012
5:37 pm
Marie Mark….You are dead right re the strength of schedule BS… GA’s SOS #42. ALA’s SOS#39. UGA haters are just like Democrats…keep repeating a lie often enough and the uninformed will start to believe it.
31 comments and my prediction
November 30th, 2012
5:37 pm
Bama 31. Ga 17 and it is not that close.
Richt Happens!
Dewnsav
November 30th, 2012
5:37 pm
ROLL TIDE, I don’t think bulletin board material is required, on either side…knock yourself out though…I’m sure Nick eagerly awaits your e-mails…not the least bit cocky, but I like our chances…and you USCe whiners, get over yourself…you beat UGA, wore us out, beat us like a rented mule…35-7, 35-7, 35-7…glad it made your season…what will you be doing at 4:00 tomorrow ?? go dogs
C'mon Man
November 30th, 2012
5:40 pm
If Dawgs win, Richt gets a big raise and a lifetime contract.
If Dawgs lose, Richt gets a raise and a 3 year extension.
What a job!
bruce mac
November 30th, 2012
5:44 pm
Less than 18 hours. What are we gonna win the pregame corn hole toss? Too dang funny.
Gator15
November 30th, 2012
5:44 pm
I have NEVER pulled for Georgia but I am going to this weekend and the main reason is your Coach.
bham dawg
November 30th, 2012
5:46 pm
bammers are so funny. mandatory suicide watch for all bammers starting at about 7 pm saturday.
Lee
November 30th, 2012
5:47 pm
Oh Gawd, I’ve heard so much yapping the past few weeks – from both sides – that I’m just ready for the damn game to be over with.
Sorta like the election….
No matter who wins, Ga or AL, I hope they stomp the crap out of Notre Dame.
Did I mention that I really don’t like ND?
UGA Shocks the SEC
November 30th, 2012
5:48 pm
Get ready bammer, we comin’ for ya boy! About time things get back to where they should be. Georgia Bulldogs baby! Believe it!!!!!!!!!!!!!!!
TampaDawg
November 30th, 2012
5:49 pm
ARDawg, Silver Fox and Sandiegodawg with the comments of the day!
Jimmy Crack
November 30th, 2012
5:51 pm
¡Bobo Believe!
TampaDawg
November 30th, 2012
5:51 pm
Gator15, thanks for the support .. one for the good guys coming
ARdawg
November 30th, 2012
5:51 pm
There is nothing to indicate a blow out by either team. It’s going to be a good game and likely the team with the ball last will win it. Put down the kool aid and be realistic. (Hoping for an easy win) but it ain’t going to happen.
GATA and GO DAWGS!!!
GATA
November 30th, 2012
5:52 pm
Espn said if GA has any chance it’s verrrrry small. I love it they are gonna sh.t their pants when the dogs roll the tide.
Joey
November 30th, 2012
5:53 pm
Not nitpicking a fellow UGA fan, NC Dawg (5:18), but if UGA loses tomorrow, it’s not a “great year.”
Good year – hell yeah!
But 11-2, and going to Tampa or Atlanta for a bowl game is not “great.”
88 Dawg
November 30th, 2012
5:53 pm
I like the way Murray has played over the last half of the season. I also like the way he has avoided the interviews this week and has focused on getting ready for Bama. If he keeps his cool and doesn’t turn the ball over and take any big losses, I like the Dogs in this game and I like them even better in Miami. Go Dogs!
Zoomie
November 30th, 2012
5:54 pm
I watched the Dawgs play against GT and saw some of the most focused, aggressive hitting I’ve seen from the present defensive group and wondered: were they just getting in the practice they knew they’d need for this opponent?
The current Dawg defense can stand with anybody. I think the big question is: how will Aaron Murray score on the biggest test he may face in his life? Does he have what it takes to be a field general at the next level, or is he just a clipboard holder, unable to channel that inner “Zen” that sets the elite apart from the rest?
UGA has all the pieces it needs to finish the drill. The USC game was just the seasoning needed to teach these young men the lessons needed to take it to the next level. Since that date, they’ve shown they have the fortitude. They have the talent; they have the leaders. Question is, do they have the heart?
GATA! Go Dawgs — Sic ‘em!
reality check
November 30th, 2012
5:55 pm
i just don’t see it…murry is 1-10 against top 25 teams…you take away FL’s 5 turnovers and he is 0-11…his national leading passer rating was some 100 points lower against SC and FL than everyone else…AJ, meanwhile is the reigning MVP of the BCS national championship game…did no one here see the UGA vs. KY game? mizzu game? how about the SC game? or the Buffalo game…? TN put up 44…meanwhile AL lost a close one to the pending heisman trophy winner…they won on the road in the 4Q at LSU…and somehow that is getting played down as a weak spot on the resume…it’s unbelievable…and on UGA getting “experience” in the dome last year…please…the last two trips have been slaughters via Boise and of course LSU…meanwhile AL seniors have played in this game 2x (1-1 vs Tebow) – they slaughtered both Clemson and VA Tech – both also in the Dome – Rose bowl againt TX, Superdome vs. LSU, jerry world vs Michigan – it’s impossible for a team to have more big game experience in big games…don’t get me started on UGA’s offensive line…Bama is going to win this one going away…unless of course they decide to black us out again…
Sunny
November 30th, 2012
5:58 pm
BAMA IS S GOOD THEY COULD BEAT ANY NFL TEAM!!!
UGA HAS NO CHANCE
Patched Tire On I-95 in Jacksonville
November 30th, 2012
5:58 pm
Joey
Be careful with what you say to NC Dawg he will claim your not a true UGA fan and will tell you to find another team to pull for with that kind of talk
Destin Dawg
November 30th, 2012
5:58 pm
Believe in the G… it’s our time.. Richt really wants this one.. Bo Bo has been getting better.. . he’ll call a good mix run/pass… TE”s will get a couple big 1st downs to keep drives alive… Grantham knows Saban.. Junkyard Defense will seal the deal in 4th Qtr….UGA 24 Bama 20
Terrence Jones, Charlie Strong and those Notre Dame unis | John Clay's Sidelines
November 30th, 2012
6:00 pm
[...] Mark Richt, the big moment is finally at hand. This entry was posted in College hoops, NBA, SEC, UK basketball, UofL [...]
SEC Championship: Ten things to know – ESPN (blog)
November 30th, 2012
6:01 pm
[...] off games in which …Georgia arrives at 'all or nothing' momentNews & ObserverFor Mark Richt and Georgia, the moment is finally at handAtlanta Journal Constitution (blog)Michael A. Lough: Georgia knows Alabama is [...]
fRUITpIK
November 30th, 2012
6:01 pm
Has Nicholas Saban ever won two BCS Championships in a row? No. History shows Nicholas Lou always chokes in this type of situation where he’s trying to win two National Championships in a row.
Nicholas Lou Saban is 0 & 2 in attempt to win 2 BCS Championships in a row.
How bout 0 & 3?
JB
November 30th, 2012
6:01 pm
I hopeful, prayerful and really pulling for the Dawgs, But The mountain is tall and The Dawgs Character in the last 3 years is not to do well in these big hyped meaningful games. Hopefully this is a new time….and this team IS NOTHING like the last 3 years teams. Go Dawgs.
delane
November 30th, 2012
6:02 pm
Markie Mark you have a great point. But, the loses Alabama and UGA have had are a little different. Amabama faced a Cam Nerton and Tim Tebow like QB. UGA faced Connor Shaw
JB
November 30th, 2012
6:03 pm
SUNNY….Is Texas A&M in the NFL?
WDog
November 30th, 2012
6:05 pm
ALABAMA looked pedestrian in both of their games against SEC ranked teams this year. I don’t see why everybody is so high on ALABAMA. Wasn’t Texas A & M favored to lose too? People really have overhyped ALABAMA and I owuld guess the UGA players are ready to make a STATEMENT.
MontanaDawg
November 30th, 2012
6:05 pm
Our keys to this game is Murray bringing his A game – no mistakes, no turnovers. And the key to Murray being on target is the offensive line giving him protection. I think Murray will be wise to use Gurshall on short passes out of the backfield as well. We’ll probably have a very tough time running effectively but maybe just enough to make play action work.
Pussy Galore
November 30th, 2012
6:06 pm
We will seize the moment! Dawgs 38 Bama 17. Then Dawgs 38 ND 7.
SauteeDawg
November 30th, 2012
6:06 pm
Good read Mark, I was telling a friend of mine about how Texas has went down hill since Muschamp went on to Florida, But have you noticed how Florida St. has struggled since Mark Richt left? Our Coach Mark Richt has paid a lot of dues in the coaching ranks. He is the longest tenured coach in the SEC and if there’s a coach that deserves to win a SEC at this point after having a couple of down years it’s him. Getting past Saban and Alabama will not be easy at all, but the team that’s playing on Saturday in the Dome is the most talented team that CMR has had at Georgia. We’ve had good teams in Athens before that had talent but not like the team we have now.
Hopefully on Saturday our team can line up and play with Bama and maybe our CMR can finally get that win that has eluded him in seasons past.
Be nice to upset Bama and get a chance to play ND. Proud of our team and coaches regardless.
Wet Willie...keep on smiling
November 30th, 2012
6:07 pm
Either team can win this game but don’t make life or death out of it!!! Have some good fun with it and just enjoy regardless. This would be THE feather in the cap of Mark while Nick has a hat full of feathers just saying. Roll Tide
Dawg Talk
November 30th, 2012
6:10 pm
Tee it up! Let’s get the show on th road! Dawgs are going to win by GATA, giving CMR win #12 in his 12th year of coaching, on the 1st day of the 12th month! This is the year of the DAWG!!!! See all of you in the NT game in January, you too Tide-E-Bowl Fans! P.S.—-Screw ESPN!!!!
cptzzggyy
November 30th, 2012
6:12 pm
If ‘Bama beats the ‘Dawgs & goes on to beat ND & win the MNC, Saban’s salary for the year will total $6 million – that’s $16,438 per day. Here’s hoping that the ‘Dawgs do their part for economic fairness by beating the Tide & limiting Saban’s compensation to a more reasonable $5.4 million.
JB
November 30th, 2012
6:12 pm
Wet Willie….Good post. I’ve had to tell myself just that this week. I’ll enjoy us getting to play Bama and measure to see where we are. Bama IS the measuring stick the last 3-4 years. I’ll give Saban a tip of the hat. He and Bama Deliver. If we win, it’ll be against the perceived best.
Patched Tire On I-95 in Jacksonville
November 30th, 2012
6:13 pm
Tech fans……………
I just wanted to know are your knees sore and eyes finally dry from begging the NCAA to let you play in a bowl game
whatnow
November 30th, 2012
6:13 pm
puppies get destroyed tomorrow. book it.
bet your whole 401k, mortgage, everything on bama.
these pups are so soft. wait till they get hit in the mouf, that’s when the will reveal their character :-
pups are b*tch a**es and will be put to sleep tomorrow.
Final rites. someone play taps.
SEC Championship: Ten things to know – ESPN (blog) | News Report Now | Daily News Magazine
November 30th, 2012
6:14 pm
[...] (11-1): 1. This is the first SEC Championship Game between teams coming off games in which …For Mark Richt and Georgia, the moment is finally at handAtlanta Journal Constitution (blog)Tide basketball faces year's biggest non-conference test [...]
63dawgj
November 30th, 2012
6:14 pm
Sabin is a tuff dude. Richt is a loveable teddy bear. Ga has talent equal to Bama EXCEPT UGA’s offensive line is much like Richt. There’s the difference
JB
November 30th, 2012
6:15 pm
Post like 6:13 are senseless. There must be a computer in the Common Area of the prison in Huntsville.
CigarDawg
November 30th, 2012
6:17 pm
You read it here first, folks: Dawgs win in the final seconds and Richt gets a lifetime contract!
Cohutta Dawgman
November 30th, 2012
6:18 pm
GO DAWGS!!!!!!!!!!!!
whatnow
November 30th, 2012
6:19 pm
if it ain’t preseason pups have no shot.
tomorrows beating will be worse than what mv7 did. ever seen an elephant trample a “slow” dog?
watch cbs tomorrow. it wont be pretty.
Joey
November 30th, 2012
6:19 pm
Congrats, whatnow.
What a mature, knowledgeable post.
You do know this is about a football game right – not some fight between some trashy girls?
dawgs25
November 30th, 2012
6:21 pm
It kills me how these bama fans keep refrencing how they beat LSU and how that should be of some major significance in this conversation………………Granted in the past few years LSU has been a team to deal with…………..but let me remind you that LSU lost to Fla………..we beat Fla…………LSU barely got Ole Miss, they beat Auburn 12-10 and only beat arkansas by 7, and gave up 22 points to Townsend so why are you throwing this out as big accomplishment.
Alabams has not beat anyone better than who georgia beat………….looking forward to a good game and may the best team win…………go DAWGS!
JB
November 30th, 2012
6:22 pm
Bama fans i’ve talked to ( Fans, with knowledge, not once a year Jiffy lube, hat on Backwards Bama fans) tell me this game could go either way. Say it’ll be breaks , not a big difference in the teams.
georgianabulltiger
November 30th, 2012
6:22 pm
Dayum, Mark. Very nice post.
AJC, give this man a raise.
whatnow
November 30th, 2012
6:23 pm
Final Rites for UGA, Thuga, Athens, and the state of GA. RIP b*tches.
http://www.youtube.com/watch?v=RU9wSaR5Qls
zbulldawg
November 30th, 2012
6:23 pm
These DAWGS are seasoned & HUNGRY !! LET THE BIG DAWG EAT
DC
November 30th, 2012
6:24 pm
How do both coaches do in big games, let’s say Bowl games, for example?
Saban has won 7 in 18 years.
Richt has won 7 in 12 years.
Richt is MUCH better in BIG GAMES.
Tndawg
November 30th, 2012
6:27 pm
Woohoo Go Dawgs! Haters gonna hate!
Joey
November 30th, 2012
6:27 pm
Hey whatnow, I’d bet MY 401K that you are the genius, Matt “CHOKE” Ryan from the Falcons blogs.
All those cute little smiley-faces and all.
Wondered where you had been since about week 4.
How’re the Eagles doin, by the way?
Alphare
November 30th, 2012
6:27 pm
Is there ever a National Champ that lost a regular season game by 28 points, like UGA did to USC 35-7?
NC Dawg
November 30th, 2012
6:28 pm
Joey, you are probably correct good year is better but after the slaughter in Columbia it seems great. However: there is a few SEC teams that wishes they were here to go 11-2.
DC
November 30th, 2012
6:30 pm
Which Coach has coached in more BCS Championships?
Richt 5, Saban 3.
Which Coach coached more Heisman winners?
Richt 2, Saban 1.
Which Coach has a higher career winning percentage?
Richt
Which Coach has less losing seasons?
Richt, by far
Which Coach has sent more guys to the NFL?
Richt
Which Coach has a player become the No 1 NFL draftpick?
Richt
Which Coach wins more big games, like Bowl Games?
Richt
Which Coach’s teams have finished in the top 5, 16 times?
Richt
Va Dawg
November 30th, 2012
6:32 pm
Best column ever, Mark. You brought your A game. Let’s hope the Dawgs do!
DC
November 30th, 2012
6:36 pm
The way I see it:
Aaron Murray is 1-1 against SEC ranked teams in 2012
AJ McCarron is 1-1 against SEC ranked teams in 2012
Both have thrown MULTIPLE interceptions in one of thsoe 2 games.
Murray beat the #2 ranked team in the country this. Better than any of AJ’s wins.
AJ lost to a Freshman QB. Murray didn’t.
Anything BEFORE 2012 doesn’t matter RIGHT NOW.
whatnow
November 30th, 2012
6:37 pm
Why would any D1 player choose UGA over Bama unless they are a b*tch a**?.
Bama has a culture of winning the “other” of pretending and living in the 80’s
Folks it will not be close.
SEC Championship: Ten things to know – ESPN (blog) | Basketball.sportsreports.tk
November 30th, 2012
6:39 pm
[...] (11-1): 1. This is the first SEC Championship Game between teams coming off games in which …For Mark Richt and Georgia, the moment is finally at handAtlanta Journal Constitution (blog)Alabama LB Mosley brings strength, speed to Tide defenseOnline [...]
He Hate Gator
November 30th, 2012
6:43 pm
Good article….was waiting for someone to write this, that this is CMR’s defining moment in his career…to win and put the inability to win the big one behind him or lose and rubber stamp his years as coach as coaching underachieving teams.
He Hate Gator
November 30th, 2012
6:46 pm
DC (Sammy), where did you get your info? ( Which Coach has coached in more BCS Championships? Richt 5, Saban 3.)
Richt (and it says so in the article) has NEVER coached in a BCS Championship game…
Strat Cat Dawg
November 30th, 2012
6:48 pm
I shake my head when political opinions are mixed with sports insults. I would imagine quite a few of the Dawgs we’re counting on to beat Bama supported the Democrats but so what? This is a football game. What say we leave party affiliation out of the equation? Go Dawgs, whomever you voted for.
He Hate Gator
November 30th, 2012
6:48 pm
…not as the head coach….
Cohutta Dawgman
November 30th, 2012
6:49 pm
DAWGS RULE!!!!!!!!!!!!!
Joey
November 30th, 2012
6:49 pm
Correct NC Dawg, and not just SEC teams, wishing they were in our shoes.
It’s gonna be hard to breath after 4pm tomorrow.
Go Dawgs.
1969 Graduate
November 30th, 2012
6:49 pm
It’s all about how the teams play, and the coaches coach on Saturday.
I’ll be keeping my eyes on the nose guards and the OL. Usually you can tell a lot about what’s going to happen by watching these positions for the first few possessions. Not always, but usually.
I think both teams – if not the fans of both teams – have a great deal of respect for the abilities of their opponents. They should. These teams have both played well this year, and both have overcome a significant loss, and both have battled well in games they could have otherwise lost (LSU, Kentucky).
It should be a good game. I think it will go our way.
Go, Georgia Bulldawgs!
Cohutta Dawgman
November 30th, 2012
6:51 pm
Know why you can’t identify a body in Alabama. All of the DNA mtches and their ain’t no dental evidence.
Patched Tire On I-95 in Jacksonville
November 30th, 2012
6:53 pm
DC; Sammy; Columbus; Dizzy
Why do you have to continue to change your name
Joey
November 30th, 2012
6:53 pm
You look it up, Alphare (6:27), or just ask again every couple hours.
Look this up too, while you’re at it: has any team other than one EVER won half of a national championship in the Tangerine Bowl vs a 3 loss team?
Patched Tire On I-95 in Jacksonville
November 30th, 2012
6:55 pm
and ranked #17
heath
November 30th, 2012
6:55 pm
This is one of the worst written articles I’ve seen in a while. I understand your point, the information is there, and I respect your opinion. However, the syntax and just basic flow is awful.
Spanky
November 30th, 2012
6:57 pm
Good post, 69 Grad! ..and to all my fellow dawg brothers and sisters who have waited so long for this moment, IT IS FINALLY HERE!! We have stood by our dawgs, and have defended our loyalty (unlike other fans of a school who just hide behind the success of other teams)… How the heck am I supposed to sleep tonight?! LOL!! Go Dawgs!!
Patched Tire On I-95 in Jacksonville
November 30th, 2012
6:57 pm
What Team claims national Titles that are shared by multiple teams without having won 1 outright
Yea its The Ramblin Joke From North Ave
Joey
November 30th, 2012
6:57 pm
“Why do you have to continue to change your name”
*************************************
Don’t expect an answer, Patched Tire.
Anybody who writes this knows what an idiot everybody thinks he is: “Which Coach has coached in more BCS Championships? Richt 5, Saban 3.
WTH?
Joey
November 30th, 2012
7:00 pm
Heath, why don’t you rewrite Mark’s post and send it to him, with a bill for services rendered?
I’m sure he will rush payment . . .
Patched Tire On I-95 in Jacksonville
November 30th, 2012
7:01 pm
Joey
I guess Kirby Smart coached 2 National Titles along with Muschamp
Saban Never Sleeps
November 30th, 2012
7:02 pm
You leg humpers need to know that the more you dream, the deeper the despair. Hang around after the game for Ramma Jammer
Competing SEC factions stump for privilege of beating Notre Dame – SI.com | football.sportreports.tk
November 30th, 2012
7:04 pm
[...] play-in gameESPN (blog)Keys to victory for Alabama, Georgia in SEC championship gameNOLA.comFor Mark Richt and Georgia, the moment is finally at handAtlanta Journal Constitution (blog)Online Athens -Patch.com -Roll ‘Bama Rollall 573 [...]
Erk's quote just one more time men !!!
November 30th, 2012
7:08 pm
GATAGATAGATAGATAGATAGATAGATAGATAGATA andGATA SOME MORE!!!!!!
GO DAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWGS !!!!!!!!
Rabbit
November 30th, 2012
7:08 pm
I believe the dogs are talented enough to win, but if, for even a minute, they think they’re better, that they won’t have to have the face saving intensity Sean Williams inspired at Fla., the minute they start believing Mark Bradley, it’s over.
I think the Dogs can win. I want them to. But they will walk onto a field against a team that will hit them hard and bring a strong desire to win and bring a history. Larry would say, “Hunker down, dogs.”
Saban Never Sleeps
November 30th, 2012
7:08 pm
Mark Bradley – have you gone absolutely nuts?? You are picking the leg humpers 27-20? Good god man, get to the hospital quickly as there still may be time to save you!!! Bama is going to take the ball and ram it down the leg humpers throats. Bama 34 Leg humpers 13
Joey
November 30th, 2012
7:09 pm
He does occasionally find some good stats, Patched, but then stuffs the the majority of his post with total BS.
What do you think about tomorrow? Think Richt is up to it?
Patched Tire On I-95 in Jacksonville
November 30th, 2012
7:11 pm
You would think that with all the upsets that have occured in the history of sports you would think fans would learn not to talk trash until after the game has been played
If Bama wins tomorrow the insurance companies will breath a sigh of relief because they wont have to pay out damages to Mobile Homes being destroyed due to a loss
#1bamafan
November 30th, 2012
7:13 pm
Only one thing left to say now…..RTR, the time is near.
Patched Tire On I-95 in Jacksonville
November 30th, 2012
7:17 pm
Joey
I hope Richt is up to it; I will be disappointed if they come out and call conservative plays like they did last year against Boise
I want to see Richt lay it all out
I know if I was in his position what do you have to lose; If he loses he will forever be branded a coach like Beamer that cant win the big game; if he wins UGA and Richt will start to get the respect that is deserved
Saban Never Sleeps
November 30th, 2012
7:18 pm
Amen #1Bamafan
Joey
November 30th, 2012
7:19 pm
Amen.
I hope he does it.
Cousin Curtis
November 30th, 2012
7:20 pm
Bama 31
Dawgs 21
georgianabulltiger
November 30th, 2012
7:20 pm
So, I read today that the New Orleans Roll Tide Pride Teabagger is going to get 2 years, serve 11 mos. You just have to admire Alabama football for all they’ve accomplished in the last few years, while at the same time navigating your way around Bama football fans:
http://sportsillustrated.cnn.com/2012/football/ncaa/10/02/alabama-lsu-bcs-video.ap/index.html#ixzz28Eq8932h
Under The Bleachers
November 30th, 2012
7:23 pm
Just want to say first. Good Luck to UGA, no matter who wins( I am hoping Alabama) I will be the biggest fan of the winner against Notre Dame in January.
I think UGA has a great team,especially on defense. They have earned their right to play in the game while others fell.
Now the part where I may make UGA fans mad, but they are just opinions, Since the UF game in which the CBS TV crew called “horrible to watch” many of the UGA fans have gotten all up about how good UGA is after playing teams that were for the most part average to less than average. I know I know, the same can be said about Alabama, but after UGA fell behind 21-0 early against USC we saw a teams efforts not live up to that level when things went bad. Alabama fell behind 20-0 and came back but still lost on the last minute interception. This is going to be a good game, I hope just to show the rest of the nation how Conference Championship games are played at the Big Boy level. But I just see UGA folding again if they get behind by more than 2 scores in the second half.
Once again Good Luck Dawg Fans!
The Nature Boy
November 30th, 2012
7:24 pm
Roll Tide Roll..right down the toilet and into the bowl…….Lou Holtz picked the dawgs…and I puked in the toilet bowl…..GO DAWGS!!!!
Wet Willie...keep on smiling
November 30th, 2012
7:29 pm
I am an old guy and have been apart of the Coach Bryant great years but like most younguns we thought they would never end and if we didn’t win the NC each year then we failed! As the years rolled by you then start(should) understand just how much work and much luck it takes to WIN JUST 1 NC. Last years NC for Bama was just amazing in that the luck we had with everybody getting beat in order for us to get into the game. The blasting of LSU was sweet no doubt and that NC was the cool whip on the apple pie for me. Not sure I will ever see Bama win another but if not then that is fine for we’ve had a plenty in my lifetime. I hate to see that many fans believe their team has failed when they finish at 10-2,11-1 and a nice bowl game. It takes a great coaching,playing,injury luck, and schedule luck to get that glass bowl and that doesn’t always fall your way. Lot of you good folks slam Nick Saban and often and 99% of you know nothing of the man and that is sad. I can tell you first hand Nick understands he is not the smartest coach (person) in football and his deep belief is he has to outwork any and all to have success. He will be beat but nobody will ever outwork the guy and at his age that is saying a bunch. 24/7/365 is all football and most other things are clutter. Best of luck and Roll Tide.
Saban Never Sleeps
November 30th, 2012
7:30 pm
Nature Boy, Lou picked the leg humpers because he knows Bama will destroy his beloved Irish. Bring your best tomorrow. make sure your pads are strapped a little tighter because there will be some hitting.
kingdaddy
November 30th, 2012
7:31 pm
You guys play nice tonight. Where’s all the douchebag nerds oretending to be Bama fans???
bob
November 30th, 2012
7:32 pm
Ga did beat Fla by a hair.Who else? Thier division is soooo weak.If they played the other division schedule,they would not be a top 10.
Vampire Bill
November 30th, 2012
7:34 pm
Either dawgs by 3 (yah) or bammer by 21
Discount DoubleDawg
November 30th, 2012
7:35 pm
bob- You might be right but if Georgia wins tomorrow you are wrong… we will just have to wait and see. Most think Georgia has a good shot.
Patched Tire On I-95 in Jacksonville
November 30th, 2012
7:39 pm
Saban Never Sleeps
Thanks for the advice
I would also like to add please make sure your house on wheels is tied up to the back of your rusty mid 70’s model pick up truck on your way to the game
oh and please try not to litter your beer cans and chew spit in our beautiful state
Atlanta hosts SEC’s play-in game – ESPN (blog) | football.sportreports.tk
November 30th, 2012
7:42 pm
[...] Post (blog)Keys to victory for Alabama, Georgia in SEC championship gameNOLA.comSun-Sentinel -Atlanta Journal Constitution (blog) -USA TODAYall 584 news articles » http://news.google.com [...]
Paul Finebum
November 30th, 2012
7:46 pm
I WILL GROW HAIR IF UGA WINS!
kingdaddy
November 30th, 2012
7:48 pm
I must be tired, I have nothing to say. Probably a good thing…
Paul Finebum
November 30th, 2012
7:50 pm
I WILL GET MY EARS PIERCED !
Jimmy Crack
November 30th, 2012
7:52 pm
How could anyone tell what Lou Holtz says?
Paul Finebum
November 30th, 2012
7:54 pm
HEY NATURE BOY,DID YOU HAVE TO WALK OUTSIDE TO GET TO IT?
The Nature Boy
November 30th, 2012
7:24 pm
Roll Tide Roll..right down the toilet and into the bowl…….Lou Holtz picked the dawgs…and I puked in the toilet bowl…..GO DAWGS!!!!
Myst
November 30th, 2012
7:57 pm
Mark Richt has coached in 3 National Title games:
1998, 1999, 2000
Mark Richt’s offense at FSU was prolific enbough to get FSU into the National Championship 3 years in a row.
Nick Saban will never match that.
Danny Ford
November 30th, 2012
8:00 pm
Georgia coming in third place is not bad for a coach & staff that everyone wanted fired last year.
A look at the 76th day of the NHL lockout – Washington Post
November 30th, 2012
8:02 pm
[...] of beating Notre DameSI.comPredicting Alabama vs. GeorgiaHuffington Post (blog)Sun-Sentinel -Atlanta Journal Constitution (blog) -Times-Journalall 596 news [...]
The Nature Boy
November 30th, 2012
8:03 pm
we got indoor plumbing…but when I turn the water on I hear a whistling noise…(air in the pipes..??) cant afford a plumber…but there is plenty of bud ice in the fridge…..GO DAWGS!!
dawgs25
November 30th, 2012
8:06 pm
at bob………………..who did Alabama beat?
Patched Tire On I-95 in Jacksonville
November 30th, 2012
8:06 pm
Sammy; Dizzy; Columbus DC now I see its Myst
Bobby Bowden was the head coach of those teams not Richt
Rick in Warner Robins
November 30th, 2012
8:07 pm
I don’t know how anyone believes UGA has half a chance against Bama. UGA is not in the same league as Bama…beating all these mediocre, barely middle school teams is going to show tomorrow…UGA fans will be boo-hooing all the way home. Poor little bull dawgies…
Bama by at least 20.
The Nature Boy
November 30th, 2012
8:07 pm
Danny Ford is so crooked that I cant figure out how he puts his pants on……
dawgs25
November 30th, 2012
8:08 pm
at bob ………….who did alabama beat………………..georgia beat the then #2 team in the country……….what is the highest ranked team at the time of the game that alabama beat……..oh and by the by …………florida is ranked #4 now………and where is the best team that alabama ranked now???
Nothing wrong with Georgia’s and Alabama’s differing pre-game mentalities … – al.com | football.sportreports.tk
November 30th, 2012
8:10 pm
[...] of beating Notre DameSI.comPredicting Alabama vs. GeorgiaHuffington Post (blog)Sun-Sentinel -Atlanta Journal Constitution (blog) -USA TODAYall 597 news articles » http://news.google.com [...]
Danny Ford
November 30th, 2012
8:12 pm
Watch it!
Coffee Bluff DAWG
November 30th, 2012
8:13 pm
Mark,
Good article and nice comment “UGA pounds Georgia Tech like a kettledrum”.
CPJ called it a thumping but what I saw in Athens was more like GT getting crushed or destroyed.
Tomorrow won’t be like playing GT so DAWGS will have to play maybe better than 2nd half against FL.
Should be great and close deep into the 4th.
The Nature Boy
November 30th, 2012
8:22 pm
Danny Ford started cheating in nursery school…….
kingdaddy
November 30th, 2012
8:26 pm
Damn, I opened the door, and nobody walked in, lol…me and Jose are going to the Dew Drop Inn. Bring your happy a$$…
JB
November 30th, 2012
8:27 pm
Interesting IMO that the outcome will depend on how Dawgs play, Not Bama. A Saban coached team ( And I’m ALL DAWG) Is pretty predictable. Dawgs, not so much.Bama throws the ball 5 to 10 yards better than anyone I’ve ever watched to move the chains. If you don’t defend it, they will do it all night. They do it out of 3rd and 3 or 4. Bama is so good because you rarely get them in 3rd and long. Go Dawgs
ARdawg
November 30th, 2012
8:27 pm
Under the Bleachers
Good luck to your boys and may the best team win *cough* GEORGIA*cough*
Please don’t turn into a Tech fans on us. Georgia’s schedule is what it is. Bama’s schedule is no more impressive unless you wish to hang your hat on Meesheegan. Really? Meesheegan?
Georgia beat 11 of the teams that showed up on gameday, just like Bama. Georgia’s lone loss was at the same place Bama lost a couple of years ago and for much the same reason. The winner of this game will continue on and dismantle ND and if it’s not my Dawgs I will be a Bama fan
WestOfAthens
November 30th, 2012
8:27 pm
I have read enough of this, watched enough, and listened to enough of the breakdown of this MONSTER game on Saturday.
Ready for kickoff, the BEST team will win.
Stars align HBTD
ARdawg
November 30th, 2012
8:30 pm
Let the Big Dawg eat!!!!
indianaDawgfan
November 30th, 2012
8:31 pm
Great things can be accomplished by winning tomorrow. Winning these games are what change recruiting wars for America’s best college prospects, the high school players who live in Georgia.
lifelongUGAfan
November 30th, 2012
8:34 pm
All of the “what if’s”, “easy schedule”, and “UGA’s past” is over at 4:00 PM Saturday. It doesn’t matter how you get there or who you beat, the bottom line is Notre Dame earned the right to play for the National Title and the winner of Ala and Uga will join them. Sounds to me like a bunch of sour grapes out there. Every fan EXCEPT those of Notre Dame, Ala., and Uga. wish their team was still in the grand hunt. Therefore, they get on here and bash the Dawgs. I have been a Uga fan since I was old enough to decide. Every year I wish the Dawgs could make the NC game. When those hopes fade, I cheer for the SEC. Why not because in college football, NO other conference is as strong and relevant every year. GO DAWGS and the SEC!
william cranman
November 30th, 2012
8:35 pm
Mark, great column as usual. I really enjoy your work. Go Dawgs!
indianaDawgfan
November 30th, 2012
8:39 pm
Georgia seems to be home to the two sorriest 11-1 teams in the history of football, Georgia and the Atlanta Falcons. Being a Georgia native, I understand. Go Dawgs, and go Falcons.
Bitter dawg fan
November 30th, 2012
8:40 pm
This will be like——- ali vs frazier—-cant wait
———————–GO DAWGS———PS—TUSK–UR–LOOSERS
WestOfAthens
November 30th, 2012
8:40 pm
As a Dawg Fan, and most apparent, a Mark Richt fan, simply thankful to even be in this position. After ‘02 and ‘07 (without question Richt’s best teams, comparable to this years) fate rests in UGA’s control. Plenty of teams out there that wish to be in other’s shoes at the moment.
HBTD
jb
November 30th, 2012
8:41 pm
Alabama by 13 or more
Dewnsav
November 30th, 2012
8:42 pm
@Wet Willie…agree with your 7:29 post 100%…not only do you need great players and coaching, you need breaks/bounces going your way to win it all…and if you’re in the SEC, it is war almost weekly…Mt. Cody, blocked field goal(s) against Tennessee…LSU needing a bunch of teams to lose in the last week, and it happened…this year’s storyline will be Oregon and K-State, both prohibitive favorites, going down in the same night opening the door for the SEC champ to slide in the driver’s seat…who ‘da thunk it…don’t know who will win, but hope it is a barn burner with the dogs coming out on top…go dogs
ARdawg
November 30th, 2012
8:42 pm
Makes me nervous as a hooker in church when Holtz picks Georgia to win anything. Has that ever happened?
indianaDawgfan
November 30th, 2012
8:45 pm
“God doesn’t care who wins football games, but His Mother does.”– Lou Holtz. Yes he said that. He wants Georgia to win because he thinks they are easier for the Virgin Mary’s team to beat.
dawgette
November 30th, 2012
8:46 pm
Good luck Coach Richt & you hairy DAWGS!
WestOfAthens
November 30th, 2012
8:46 pm
ARdawg: Holtz wants the rematch as well, albeit he is the homer of all homers the 4 letter network employs.
Pollack picked Florida!
Predictor
November 30th, 2012
8:46 pm
UA 42 – UGA 14
Great Falconi
November 30th, 2012
8:47 pm
I think we all knew Mark would pick the Dawgs to win this one. Let’s hope he’s right.
The Nature Boy
November 30th, 2012
8:48 pm
@ARdawg…I’m as nervous as a cat in a rocking chair factory….
blamegame
November 30th, 2012
8:50 pm
Bammy has the fear fever
WestOfAthens
November 30th, 2012
8:51 pm
Had a surge of curiousity. I asked “what was that?”
There was a sense, compelling tone, telling me “Georgia will win tomorrow”
I asked “how?” It replied “Georgia will win tomorrow”
HBTD
This one is personal
November 30th, 2012
8:52 pm
For Richt. . . win here and he leaves a legacy. Quiets the doubters. Lose here and the nay-sayers will continue to criticize. For Saban, its just another game, another chance, it does not rise to the same level.
Dogs win by 3.
Mobile Dawg
November 30th, 2012
9:03 pm
This is going to be a high pressure game the first few minutes, I hope the coaches give the (offense) players (Murray) a chance to settle in before opening the floodgates.
ARdawg
November 30th, 2012
9:07 pm
WestOF
Yes he is. The 4 letter network (I like that) attempts to try and appear “objective” while snicker all the time. No matter the game May and Holtz will disagree. The problem with that is the personalities egos are too big. When they are right we never hear the end of it and when they are wrong we never hear it again. Nothing but ego and marketing
GATA
November 30th, 2012
9:12 pm
I just hope we don’t gotta beat the tide and officials too
no dawg
November 30th, 2012
9:13 pm
No more waiting
no dawg
November 30th, 2012
9:14 pm
Beat down on the way ROLL TIDE
Discount DoubleDawg
November 30th, 2012
9:16 pm
This is what it’s all about boys… playing football in December with a chance to play for a National Championship. I was young when Herschel ran wild and the Dawgs were THE team in the early 80’s. In some ways it was those games from 80 through 82 that made me such a football fan.
My years in Athens were not as fruitful as I sat and watched the Goff era end and the Donnan era begin. I love UGA, Athens, and of course Georgia football but those were some tough years. Those years are why I am such a supporter of Richt today (that and watching UT fire Fulmer and suffer).
Anyway, here we are today with a chance… and I just love it. If we lose I will be disappointed and a little frustrated but I will still bleed red and black and will support Richt and team no matter what. However, I just have a hunch… just a small hunch that this just might be the year. This might be our time when things go our way.
–Gurley rips off a 61 yard TD run… Murray dials in a sweet fade pass to TK for a score. Sack-Man Jones blindsides AJM and causes a fumble. Ogletree makes a drive stopping tackle in the 4th.– Maybe I am just dreaming, but maybe not… I probably am because I can almost hear Munson as I type this.
If we win, here is how- the O line plays well, Gurley/Marshall go for 150+, win the turnover battle, and above all else Murray has a good game.
I will be there tomorrow at 4pm and I am looking forward to seeing what happens. Win or lose I am a DAWG… but tomorrow I say we win. I don’t predict scores but I do predict a W.
Go DAWSG!
GATA
November 30th, 2012
9:17 pm
@ no dawg I got 2 Benjamin’s in my pocket that says your full of sh.t
Deep Down Inside
November 30th, 2012
9:17 pm
The best team doesn’t always win. They usually do, but not always.
UGA is hoping that the best team doesn’t win tomorrow. It could happen. I’d give the Dawgs about 20% odds of pulling off the upset.
no dawg
November 30th, 2012
9:19 pm
Do you guys really think you can win.
Roy
November 30th, 2012
9:20 pm
For A lot of players on Bama’s team this will be their first experience on a big stage so don’t make it seem like UGA has never been on this stage. They were just here last year..Bama hasn’t been in the SEC title game since 2009. UGA has that advantage. Alabama is a good team yes, but are they unbeatable? Hell no. Let’s do it Dawgs! If the O-line blocks, UGA wins.
Discount DoubleDawg
November 30th, 2012
9:21 pm
Go DAWGS!
sorry… got a little too fired up there at the end of the last post
jlmdra
November 30th, 2012
9:23 pm
Bet on Saban and the triumph of evil.
Big Game
November 30th, 2012
9:24 pm
Sure, Georgia has played in some big games lately. They just haven’t won any of them.
Roy
November 30th, 2012
9:25 pm
If our defense can consistently get Bama’s offense in 3rd and long, I just don’t think McCarron can drop back and pass the ball 30 times to win this game. Shutting down Lacy and Yeldon is going to be crucial. It won’t be easy, but I think we have the linebackers to do it. Jones, Ogletree, Hererra, Gilliard, Jordan Jenkins, etc…and we have the biggest D-line in college football playing with their hair on fire….we’ll be fine on defense.
GATA
November 30th, 2012
9:25 pm
NO DAWG you act like the tide are the 84 bears. Trust me GA will give your boys hell watch and see
Under The Bleachers
November 30th, 2012
9:26 pm
ARDawg,
Hope all is well sir.
I was not trying to downgrade UGA’s Schedule, I was marking the way UGA played earlier in the year against teams they should have blown out early but allowed to hang around, ie Tennessee.
I cannot say anything about schedule unless it involves outer conference stuff and Alabama’s outside of Michigan in Dallas was not much to be desired( by the way if UGA loses they play Michigan in the Capitol One Bowl).
Good luck to you and your dawgs but not too much luck, You guys have a great team.
Roy
November 30th, 2012
9:27 pm
I also expect Gurley to get the ball a lot in this one. Sort of the way he carried the ball vs. Florida (another great defense)…Gurley ran 27 times for 118 yards and a touchdown vs. Florida. This isn’t Keith Marshall’s kinda game. He’s just not the pounder Gurley is. This is the game that Gurley belongs in. He’s big, powerful, physical, and he also has great speed. Give Gurley 30 carries in this one. He’ll be a tired young man, and probably beat up, but we’ll be raising the trophy if we do.
Big Game
November 30th, 2012
9:27 pm
Roy,
Why do you believe that AJ will suddenly lose his ability to play quarterback?
I guess hoping the other team doesn’t show up is a strategy… Sort of.
Under The Bleachers
November 30th, 2012
9:28 pm
UGA will have to load the box to stop the run, and then your OLB’s will have to cover TE’s leaving big gaps behind them for crossing routes, typical NFL offense as Saban likes to run.
Discount DoubleDawg
November 30th, 2012
9:31 pm
The x’s and o’s and certainly important tomorrow. In fact, very important. I just think momemtum is critical tomorrow. Not just in the 1st quarter but especially in the second half. I think the team that comes out in the second half with the best game-plan and intensity will win. A few big plays in the second half will probably win the game.
no dawg
November 30th, 2012
9:33 pm
GATA I will enjoy watching your mutts lose another big game.They always do.
Discount DoubleDawg
November 30th, 2012
9:37 pm
no dawg- what year did you drop out of tech?
Big Game
November 30th, 2012
9:40 pm
At some point in the game tomorrow, Georgia will quit. I just hope that, when they do, their undisciplined defensive players won’t spend the rest of the game attempting to injure players out of frustration. Georgia is a very dirty football team. Thug U was definitely a characteristic that Mark Richt brought with him from Free Shoes University.
valinor
November 30th, 2012
9:42 pm
National Championship? Really? This is it! Everyone here should be an SEC fan… If not than you need to get a life… tomorrow is our game… win or lose… this is the SEC baby… screw the game in January… that’s for everybody else…
Roy
November 30th, 2012
9:46 pm
McCarron isn’t on Murray’s level as far as slinging the ball around. McCarron is more of a game manager, short pass, high percentage type QB (which is not an insult)…Murray is your typical drop back passer…he’s #1 in the nation in passing efficiency…he’s the only QB in SEC history to pass for more than 3,000 yards in 3 consecutive seasons and he’s going to break the SEC’s All-Time record for touchdowns if he comes back next year.
no dawg
November 30th, 2012
9:46 pm
Discount DoubleDawg Atter the beat down You can always say wait to next year.
indianaDawgfan
November 30th, 2012
9:47 pm
Bama Fans, you know this is your future. If you win tomorrow, a rich booster from one of the SEC schools will find where your guys paid for some of those kids. You want to deny it, but deep down you know it’s true. And Saban is not Bear Bryant. He didn’t hear “mama callin” when he was hired. He’s restless and he’s only happy when he’s unhappy. So whether you win tomorrow or not, you’ve pissed too many people off. And Notre Dame will beat you because you are Alabama and they are Notre Dame. You lose to Notre Dame in games like that. Ask your daddies and granddaddies. Ask Oklahoma. And believe me, I hate Notre Dame.
Big Game
November 30th, 2012
9:49 pm
@Roy
It’s pretty obvious that you’ve never seen AJ McCarron play football. You’ll get your chance tomorrow.
Discount DoubleDawg
November 30th, 2012
9:49 pm
big game, did you and no dawg both drop out of tech together? hurts to be a techie doesn’t it? Envy and insecurity obviously rule your world. With every post of yours I smile because of what it says about you.
Big Game
November 30th, 2012
9:50 pm
indianaDawgfan: Just like Georgia Dawg Fans.
Excuses. Not only excuses… Preemptive excuses.
Big Game
November 30th, 2012
9:51 pm
We don’t play that cheezy little Tech team any more since we ran them out of the conference.
Discount DoubleDawg
November 30th, 2012
9:51 pm
no dawg- I could say that, but you can’t. the envy and insecurity is about to boil over isn’t it?
Big Game
November 30th, 2012
9:54 pm
I feel pretty good. Dawgs know, deep down inside… They have a natural ability to sense the presence of the Alpha.
Bama owns the Dome. They may be wearing white, but they’ll have the home team advantage tomorrow.
t2go
November 30th, 2012
9:55 pm
http://cfn.scout.com/2/1244434.html
Here comes the BOOM!!
Sierra Dawg
November 30th, 2012
9:57 pm
I seem to recall that the last time Nick Saban brought a highly-ranked, heavily-favored team to the SEC Championship game to play Richt’s Dawgs, he got slobberknocked – and good. I also believe Richt has won 2 of his last 3 against Bama’s legend-in-waiting. That one loss to Saban in 2008 was a tale of two halves. Yes, Bama ran out to a 31-0 halftime lead, but UGA roared back 30-10 in the second half. It was not the ass-kicking Bama folks like to describe. The last 5 minutes of the game, Saban was the most worried-looking coach I’ve ever seen.
The thought of playing a Saban team may scare many coaches silly, but it doesn’t seem to intimidate CMR. I’d also remind folks that the recent seasons where UGA has under-performed, Mark’s wife was battling cancer. Who the hell wouldn’t lose their edge? Someone human, anyway. I feel like Mark has his focus back this year, and I expect a great game tomorrow. If Bama is the least bit overconfident and living their own press, the Dawgs are likely to slap them silly before they have a clue what’s happening.
t2go
November 30th, 2012
9:58 pm
Dawgs D is SOFT!!!!
Go Dawgs!!!
Big Game
November 30th, 2012
9:58 pm
Mark Richt has already lost this game by failing to prepare to win it. It’s just a matter of time now.
Sleep tight li’l Dawggies!
no dawg
November 30th, 2012
9:59 pm
Discount DoubleDawg You thinking GA can actually beat ALABAMAsays a lot about your mental status.
Roy
November 30th, 2012
10:01 pm
@ Big Game, I don’t see how you can say Bama owns the Dome since they haven’t been since 2009.
ARdawg
November 30th, 2012
10:01 pm
Under the Bleachers
No worries there guy, it’s all good. It’s going to be a good game with two of the best teams in the country. Nothing will come easy or cheap. The best team will win.
I believe we will stop your running game and McCarron will be pressured to perform. The bigger question is can your D slow our running game and put the pressure on Murray’s passing attack. I do like our chances. If Bama has a passing game we’d better see it tomorrow or your guys will lose. I don’t think you’ll beat us on the ground
indianaDawgfan
November 30th, 2012
10:01 pm
Oh no Big Game, it’s not preemptive. If you’re going to play all of the Auras, check Notre Dame’s. if you want to put stock in what happened five minutes ago, five years ago or whenever, don’t be selective. Play it ALL THE WAY THROUGH. Two things will happen. You will be on probation. This is a given. Saban will run. And Alabama will lose to Notre Dame. I’m already wondering how many of your games will be forfeited. Have someone read to you about Alabama and Notre Dame if you were born last week, okay.
Big Game
November 30th, 2012
10:01 pm
Hide & Watch!
ARdawg
November 30th, 2012
10:02 pm
no dawg,
42-10
Roy
November 30th, 2012
10:02 pm
Bama fans on this board= Tech fans…same thing every year. Tech fans hide behind Bama’s name. They used to hide behind Auburn until we beat the crap outta them the past two years, then it was Florida but we beat them the past two years, and now it’s Alabama. But once we beat them tomorrow, they’ll turn into Notre Dame “fans”. LMAO
Big Game
November 30th, 2012
10:03 pm
Notre Dame?
HA! HA! HA! HA! HA! HA! HA! HA! HA! HA! HA! HA! HA! HA! HA! HA! HA! HA! HA! HA! HA! HA! HA!
Big Game
November 30th, 2012
10:04 pm
Roy,
Nobody outside of Atlanta knows or cares who the Techies even are.
Discount DoubleDawg
November 30th, 2012
10:06 pm
no dawg- my mental status does not include envy and insecurity as does yours… are you excited about tech’s big game? who is your favorite tech player? why are you on a georgia football blog? I feel sorry for you little guy
ARdawg
November 30th, 2012
10:09 pm
Big Game
November 30th, 2012
10:04 pm
Roy,
Nobody outside of Atlanta knows or cares who the Techies even are.
———————————————————
Plenty of Pakistanis and Central Asians do though
indianaDawgfan
November 30th, 2012
10:15 pm
Notre Dame is Alabama’s kryptonite. Do I think they are better? I don’t think it matters. Their history trumps yours. And they will beat you again if my long suffering Dawgs don’t do the deed tomorrow night. And I’m not saying we won’t beat you. But this is not the best team we’ve had under Richt, not by a long shot. Wouldn’t you rather lose to us? Seriously, I mean you can do something about that because you might play us again. You can’t play Notre Dame unless you have bowl eligibility, and in the near future you won’t.
tony
November 30th, 2012
10:17 pm
Are our backup qbs not learning the playbook, undercoached or just not that good? Sc is winning BIG with a 2 star backup qb(Dylan Thompson) and Connor Shaw is a 3 star qb who took down the dawgs in Columbia. What’s going on in Athens?
Under The Bleachers
November 30th, 2012
10:38 pm
Ardawg,
I am not too worried about running the ball on UGA, too many hosses for us upfront even with your big guys, but I expect Saban will use the TE’s a great deal to take your linebackers out of the seam and then pound once he gets them leaning outside for the flat routes. I think we force Murray to win the game with his arm( which he can do without pressure) and let the backs have to catch the ball to get yards. The cut back runs are what worries me the most and all of Bobo’s little trick plays he always runs a few times a game.
Good Luck and catch you after the game.
Under The Bleachers
November 30th, 2012
10:46 pm
http://www.al.com/alabamafootball/index.ssf/2012/11/scarbinsky_2.html
Nice read! Love the last two sentences, and the comment about Todd Grantham.
Under The Bleachers
November 30th, 2012
10:52 pm
From Gary Danielson this week via the NYT:
Just look at their schedule. They played Ole Miss at home, before Ole Miss really got going; Auburn, which is a disaster; they crushed Georgia Southern and Georgia Tech. When other teams were playing big games Georgia was playing nobody.
That’s one side.
On the other side of ball, Alabama was considered hands-down the best team in the country, almost unbeatable. But when an opponent had a competent quarterback, Zach Mettenberger of L.S.U. or Johnny Manziel at Texas A &M, they had trouble. You wonder if Alabama has some holes in their game. They’re not as elite as they appear.
So you go into the game and the two teams have a lot of question marks. Can Georgia quarterback Aaron Murray do what Mettenberger and Manziel did? He has lost his top two receivers. Will it matter? And can Georgia’s Jarvis Jones upend AJ McCarron, the Alabama quarterback, so much that it determines the game?
Here’s the real skinny: Against every good offensive line they’ve faced, Georgia’s defense has been quite generous in the running game. They’ve given up 230+ and 300+ yards to teams that like to run the football and if you know anything about Alabama, they like to pound the rock.
The game of football is won and lost on the line of scrimmage. In the college game, that’s even more so. If you depend on the quarterback to win games for you, you’ll win most but anytime you face a squad that blocks and runs better, you’re in trouble.
Eldawg
November 30th, 2012
10:54 pm
I was at that game on Jan 1 1983. Man I’m old ha.
Roy
November 30th, 2012
10:57 pm
The fat boys will decide who wins the game. It’ll all come down to the trenches.
Jekylldog
November 30th, 2012
11:02 pm
Go Dawgs!
Eldawg
November 30th, 2012
11:04 pm
Hey underwear,
If Bama runs the ball more than 80% of the time like Tech and Ga Southern, then u got no chance.
phil
November 30th, 2012
11:07 pm
Fire CMR tonight!!
Paul in NH
November 30th, 2012
11:10 pm
Dang. – I wish I was making book on this game and running different odds for the UGA fans and the ALA fans. The UGA fans will be betting heavily at UGA -5 and the Bama fans at Bama -10. Easy money.
UGA covers but doesn’t win. UGA has more talent on D, a better QB and WRs. RBs are a wash and Bama has a better OL. Comes down to coaching (Saban over Richt) and discipline (ALA over UGA).
Bg
November 30th, 2012
11:11 pm
GO DAWGS!
South Carolina DAWGS
November 30th, 2012
11:15 pm
Thanks Mark – Your have always been faithful and sincere to MY DAWGS!!! We will win the game!!!
Fact Check Time
November 30th, 2012
11:22 pm
Time for some truth and it is going to hurt you Georgia fans.
This game will be won on the line of scrimmage and UGa has an average offensive line and a defensive line that easily gets blocked on the run. The Linebackers are known for overplaying and going off script allowing big run and 4 to 15 yard gains. In fact the level of intelligence by UGA will be what gets UGa beat. One of the starting linebackers should have never been allowed to graduate as my niece taught him in high school his sophomore year and he read on a third grade level, not making that up. Rambo has a long history of making bonehead mistakes that extends drives. The UGa defense plays on too much emotion and have shown they will quit when they get behind and physically beat up. Two weeks of practice in pads for option cut blocks has made UGa very weak legged and tired. These players have a history of being selfish as their offseason habits have proven.
This will be a physical game and Alabama is a more physical team who will line up and knock you back for sixty minutes until you quit, UGa will quit.
Now your turn to call me a Techie, or whatever name you have in your plastic cooler full of PBR. The final argument is you cannot argue with any of my points except to make some off the wall bold prediction that makes your heart feel better. Not a Techie, just a fan who pays attention to others outside the state of dawg nation.
Take your Maalox in the morning you are going to need it and have a woman in your family hide your guns.
David C
November 30th, 2012
11:29 pm
Here is the Reason that Bama wins tomorrow. Didn’t realize UGA ranks 11th in the Conference. They are even behind Kentucky in Rush Defense.
RUSHING DEFENSE
Year: 2012 Thru: 11/24/12
Rank Name Gm Carries Net Avg Tds YdsGm Win Loss Ties Natl
Rank
1 Alabama 12 392 924 2.36 7 77.00 11 1 0 2
2 Florida 12 377 1159 3.07 11 96.58 11 1 0 6
3 LSU 12 390 1222 3.13 13 101.83 10 2 0 10
4 South Carolina 12 459 1428 3.11 9 119.00 10 2 0 16
5 Arkansas 12 440 1489 3.38 21 124.08 4 8 0 21
6 Ole Miss 12 447 1600 3.58 17 133.33 6 6 0 28
7 Texas A&M 12 453 1691 3.73 18 140.92 10 2 0 39
8 Missouri 12 451 1791 3.97 26 149.25 5 7 0 49
9 Vanderbilt 12 457 1807 3.95 16 150.58 8 4 0 50
10 Kentucky 12 481 1935 4.02 25 161.25 2 10 0 63
11 Georgia 12 513 1961 3.82 13 163.42 11 1 0 67
12 Mississippi St. 12 464 1992 4.29 13 166.00 8 4 0 71
13 Tennessee 12 477 2266 4.75 25 188.83 5 7 0 89
14 Auburn 12 484 2371 4.90 23 197.58 3 9 0 96
Fair n Balanced
November 30th, 2012
11:39 pm
A clear path but we have to beat the 2 most decorated programs in college football history. It won’t be easy.
Tide Rising
November 30th, 2012
11:57 pm
Alabama’s motto. We run the ball and we stop the run. Obviously UGA can’t stop the run as the no. 11 rushing defense in the conference. That spells trouble for the dawgs against a massive Alabama O-line with 3 first round draft picks on it this year alone.
This is David vs Goliath. And this time Goliath wins.
ARdawg
December 1st, 2012
12:06 am
Fact Check Time
Your truth is nothing but rumor. Your attempt to disparage a Georgia player’s reading ability to make or press your non-point is noted. Your niece is either, making up fodder, a liar or you are. 3rd grading reading level will not get one admitted into the University of Georgia no matter how good they play football. Maybe at Tech, not Athens. Your seething hatred is evident. Rambo has a much longer history of stellar play than the bonehead mistakes you wish to accredit to him. He is a baller. No good or great player wins them all. If you had played you’d probably know that.
The UGA defense was admittedly physically “beat up” once this year at Carolina. It happens, so what? Since then they have played lights out defense. The woodshed experience of your Bugs is more proof of that. Preparing for and playing against the TO isn’t going to make a dimes worth of difference and might even prove a benefit. Time will tell, won’t it?
Not a Techie and just a fan? A fan of whom? Your hatred of UGA is evident. If you’re not a Nerd you should seriously consider changing teams. You’d make a good one.
At the end of the day, it’s just a football game. Win, lose or draw at the end of the game, there’s not a thing we can do to change it. Grow up Fact Check. Get out of your Mother’s basement and quit hating.
IlliniDawg
December 1st, 2012
12:11 am
@Roy: there just might be something to your theory. Seems awfully coincidental, that’s for sure. Bottom line, why do the haters hate so much? Must be envy of some kind.
@Gator15: Thanks for the support. Like you, I never cheer for Florida, but every time Tebow was in the BCS NC Game I wanted him to win.
Rabbit
December 1st, 2012
12:12 am
Boils down to UGA O – line vs. Bama D-line. AND takeaway vs giveaway
Go Dogs.
FLA DAWG
December 1st, 2012
12:22 am
This is indeed a defining moment. If history has taught us anything it is that (lately) Dawg Nation cannot rely on Richt.
If that is the case then we lose by 3 TD’s.
FLA DAWG
CLASS OF ‘79
I hope to hell I’m wrong. I was in N.O. in 1980 for the greatest defensive NCC Game probably ever played and I’d love to see that again!
Joe Falcon
December 1st, 2012
12:30 am
I have a crazy feeling that the Dawgs are gonna win…and not just barely, but by two touchdowns…and I think Saban knows it’s coming.
That’s why he’s already complaining about how unfair it is that the loser of the SECCG is gonna go to an inferior bowl…he wasn’t saying that because he cares about where WE wind up, I assure you.
You heard it here, first. Write it down.
IlliniDawg
December 1st, 2012
12:30 am
@TideRising: agreed, your O-Line is awesome. But tomorrow there will be four to five first rounders and two to three second rounders playing on the opposite side of scrimmage from those guys: Jones, Ogletree, Jenkins, Geathers, Williams, Commings, Rambo, and Smith.
Fact Check Time
December 1st, 2012
12:39 am
Arkie doggie,
Ogletree in Newnan, it is a known fact he is dumber than a sack of hammers in the back of your pickup truck in backwoods of Arkansas. Anyone in and around Newnan will tell you that. He was admitted on special application and his test scores are known to have been taken by someone else. It is a running joke in Newnan. Plus a known pothead!
Rambo is another who will be listed at the bottom of the NFL testing levels for thinking and comprehension. He led the league in personal fouls two years ago and three years ago. He is a Bonehead player and a selfish player.
Tennessee beat them up, Kentucky beat them up, heck even Buffalo beat them up for a half.
The stats do not lie, even tech ran the ball up and down the field on them, southern had their way for a half, ole miss had them up to two minutes to go in the 1st half…
Fat slow DL will get you beat.
IlliniDawg
December 1st, 2012
12:47 am
FatCheck: dude, why the need to disparage a bunch of college athletes? Jealous? Or just a hater. Maybe you need a timeout. But your comments sound silly. If intelligence, humility, and abstinence from weed were hard criteria for playing in the NFL, I think we’d have about half a league. Bottom line is, most of the guys on our D will be playing on Sunday next year or the year after.
Jerry Seinfeld
December 1st, 2012
1:05 am
So here’s to you, Christian Robinson, Paul Johnson’s team sucks more than you would know!
Jerry Seinfeld
December 1st, 2012
1:22 am
“Alabama’s motto. We run the ball and we stop the run. Obviously UGA can’t stop the run as the no. 11 rushing defense in the conference. That spells trouble for the dawgs against a massive Alabama O-line with 3 first round draft picks on it this year alone.”
Bama’s o-line is very good, but the rush defense stats fail to tell the whole story. The run defense has improved drastically in the second half of the season, but the numbers are still bad because of their performance in the first half of the season. Kentucky and Tennessee both ran the ball very well on our defense, but look at what Florida’s running backs and quarterback did running against us. Almost nothing. About 70 yards rushing. They held Jeff Scott of Ole Miss to almost nothing. The defense overachieved the first half of the season for some reason, but you have to acknowledge the improvement they have made against pro-style rush offenses.
Eric C.
December 1st, 2012
1:31 am
@Under the Bleachers…
“They played Ole Miss at home, before Ole Miss really got going”
WTH is Danielson talking about??? Ole Miss was on a roll coming into GA. Those are the kinds of statements that make you realize the talking heads are just p****** in the wind.
Eric C.
December 1st, 2012
1:34 am
Yeah, and how about having to face two triple option teams…including the team (GA Southern) that racked up 300+ yds rushing on ALABAMA last year.
I’m tired of the stats/talk…let’s get it on! Go Dawgs!!!
Fact Check Time
December 1st, 2012
1:34 am
Illinipuppy,
The UGa players will fit right in with the drug filled criminal NFL element, they are already NFL ready in that department and you are making excuses for them.
By the way, enjoy it now because if all those players are gone next year your defense will fall from 11th to last. Add to it Clemson, LSU, USC giving you their annual beating and Florida putting a no bark collar on the puppies it is going to be a long year.
As for the players who are playing for UGa you know in the real world they would never be allowed in the school and the graduation rates over the past 5 years make my point!
Jerry Seinfeld
December 1st, 2012
1:37 am
“They played Ole Miss at home, before Ole Miss really got going”
WTH is Danielson talking about??? Ole Miss was on a roll coming into GA. Those are the kinds of statements that make you realize the talking heads are just p****** in the wind.
They had won 2 in a row, would you call that a losing streak? Never mind the fact that Georgia absolutely eliminated the Rebel running game.
Eric C.
December 1st, 2012
1:40 am
Oh and David C, here is another stat for you…the UGA offense averages more yards per play than Texas A&M, pretty cool huh?
Here we go again
December 1st, 2012
1:45 am
I have to say, I really hope the Dogs come through for us in Dog nation…BUT, either team will DESTROY Notre Dame. Were the Irish in the SEC they’d be 8-3 at best.
Philosoraptor
December 1st, 2012
1:45 am
“When people complain about Georgia schedule, do they realize Alabama didn’t play Georgia, South Carolina or Florida this season?”
“When people obsess over Alabama’s great defense only being vulnerable against a hurry-up offense, do they remember what a traditional offense with an average quarterback did against the Tide in Death Valley?”
“Do Florida fans who complain about Georgia’s schedule do so to try to cover up the fact that Georgia simply outplayed them in Jacksonville?”
Tide will Roll
December 1st, 2012
1:54 am
DoubleDawg , We will be looking for you around 2000 tonight !!!!
Tide Rolls Baby 24-10 !!!!
Crimson Pride
December 1st, 2012
2:04 am
May the best team win! I hope Bama wins and feel we have the edge because of Georgia’s offensive line, but Coach Richt has his team playing very well right now. Their defense played very well against Florida and Ole Miss. Auburn… well, everybody plays good D against that offense haha. Richt seems to have them playing with a lot of confidence. I’m not sure they will be able to put up the points against our defense though. I’ve got faith in my team but if the Dogs win, I will cheer them on for the title game because I will always pull for an SEC team over Notre Dame. say the game ends up in a 24-17 victory.
Here we go again
December 1st, 2012
2:07 am
Yada yada yap yap yap…..let ‘me play ball.. Either team is capable of whipping the other, Richt has shown, repeatedly, that he can beat Lord Saban. Either team can beat the Fartin’ Arish.
Jerry Seinfeld
December 1st, 2012
2:13 am
Georgia’s schedule may have been easier than usual, but they won most of their games comfortably. Tell me, does Georgia have to beat bad teams 50-0 in order to earn more respect? They could have run it up against Tech, but Richt is too classy and smart to not risk injury for Murray and the starters. I could understand the argument of not beating anyone if your team is winning against bad teams every week by 10 or less and hanging on to win late. But with the exception of a couple of games, Georgia has been firmly ahead throughout against the “easy” teams.
newday in GA
December 1st, 2012
2:22 am
GA will turn over a new leaf on Championships later today!
Amen corner
December 1st, 2012
2:24 am
Here we go: Is this religion or good trench football?
drbasic1
December 1st, 2012
2:48 am
did my post get eaten?
drbasic1
December 1st, 2012
2:50 am
Classy post CRIMSON PRIDE
I feel the same, just switch it around for the DAWGS!
Fact Check Time
December 1st, 2012
3:08 am
Alabama 38
Georgia 20
RedandBlackDAWG
December 1st, 2012
3:48 am
If UGA’s young OL can do a decent job, them UGA stands a good chance of winning the game. They are the key, in my estimation to making this a very good game. It is going to take a supreme effort by these young kids to win the game.
UGA has a lot to gain and lose both in this game so I hope they stay disciplined, and in control of their positions. We shouldn’t expect to score 38 points on them, and they shouldn’t expect to score 38 against the DAWGS.
It is going to be a good game, and I believe this one personifies what college football and competition is all about.
GO DAWGS AND GATA
TheDocta
December 1st, 2012
5:45 am
As Erk once said, “the underdog has half the fun, and gets to keep the puppies”.
ND Man
December 1st, 2012
6:18 am
Alabama wins in a fairly easy manner today. UGA has looked great the last few weeks, but Kentucky, Auburn, Ga Southern and Tech will make most average teams look great. UGA has played 2..TWO…DOS teams with 8 wins and they are 1-1. I would have more respect for the program if they would actually play a better OOC opponent. Dont give me the SEC schedule, LSU, TENN, ALABAMA and others try..UGA goes and gets Buffalo and directional schools…total joke that they have all of these high rated classes, great facilities but yet ALWASY choke against a team or two.
MR is a hypocrite
December 1st, 2012
6:19 am
This just shows that good things happen to bad people!
The Voice of Reason
December 1st, 2012
6:25 am
I would – and suspect the rest of the country outside Tuscaloosa – root for Communist China vs. O’Saban Bin Lyin’ and AllahBama!
Lostfan
December 1st, 2012
7:10 am
Georgia will never win a championship game under CMR and CMB. They will be outcoached at every position.
Tim Scott
December 1st, 2012
7:16 am
Alabama by 4 TDS that is. All you great Georgia fans tonight you will be on this site and others screaming for CMR to be fired. Back in the day UGA had some of the greatest fans ever now however you may be the worst I have ever seen. Roll Tide, Go Gators
Burma Shave
December 1st, 2012
7:17 am
Richt has no clue what he’s doing
His dawgs are along for the ride
At the end of the day when all is done
Triumphant will be the Crimson Tide
BURMA SHAVE
Sweet Surrender
December 1st, 2012
7:22 am
Alabama 45, Leghumpers 10
All the silly dreams turn into Richt’s biggest nightmare in the Dome today.
But wait till next year!!!
juice sourcer
December 1st, 2012
7:22 am
There are at least 10-15 teams that would have a good chance at beating this Alabama team when playing them on a “neutral” site in their home state….Standord, Kansas State, Oregon, South Carolina, etc…..hell A & M beat them in Tuscaloosa….so Georgia is just very lucky with that pathetic schedule…if they had played just one difficult team from the West….we would not even be talking about them. The best team from the East,,,,clearly its South Carolina….for the 2nd year in a row is not playing in this game…Georgia is…..whats the message…have a cupcake schedule and anything is possible.
JB
December 1st, 2012
7:24 am
Something other than what’s happened the last 3 years with Richt,Bobo and Murray has to happen. The OL is better, the defense is way better…..and pray the kicking game doesn’t decide it. The Bama kicker is 60 of 60 PAT and 10 of 10 FG………We are suspect with freshman.. Go Dawgs
silver britches
December 1st, 2012
7:26 am
Bama puts on their pants just like everyone else. A&M went thru that superman D like a dose of salts and it was 20-0 in the 1st quarter. Murray will have a field day with Bama’s suspect D backfield. Bama is in a bind right off the bat. How do you stop the passing attack without giving up big yardage to 2 backs who have 1,800. How do you stop the run if you have to drop your LBs back in coverage and keep the safties from being burned for cheap TDs. Finally Rambo, Jones, and Ogletree have to be giving Kirby Smart nightmares. Dawgs by 14.
We (did) Run The East
December 1st, 2012
7:32 am
Yep, CLEARLY the best team in East for 3 yrs now, South Carolina. Dawgs move to 3rd in East and 5th in SEC today. Dawgs don’t deserve and have not earned greatness. Gonna be a blowout! Murray failed against SC and FL and will implode today. Clowney kept him up with nightmares and I am sure AL D-line has done the same.
We (did) Run The East
December 1st, 2012
7:35 am
If you mention AM by name you get “moderated”.
Buckeye
December 1st, 2012
7:37 am
Morning dogs
GT
December 1st, 2012
7:41 am
All those years you would have thought Georgia was Alabama if you read this paper, or even FSU, but now we are told the truth as they get ready for another game at the dorm because of scheduling that strongly favors them. Florida played three top ten teams in a row, not a word of significance give by this paper. South Carolina did the same thing. I mean there is only ten teams in the entire nation and both these teams played three top ten teams in a row, Georgia played two the entire season. One that was fresh that beat them very soundly for the third time in a row and one that had two very hard games before playing Georgia and still nearly beat them if it had not been for some unexplainable luck at the end. And to add insult to injury they take Alabama off their schedule and replace them with Missouri while Alabama plays Texas A & M. Who are these guys, who do they know, how do they get away with this.
Buckeye
December 1st, 2012
7:41 am
Gonna be a long day dogs, longer night
Truth
December 1st, 2012
7:45 am
This is the best team that the University of Georgia has ever fielded.
How good are they? We will know this evening.
This is not the best team that the University of Alabama has ever fielded, but they are very good. If Georgia manages to win this game, then there is no doubt that they will go on to win the National Championship.
doc
December 1st, 2012
7:51 am
great article—Mark
Tech Sucks
December 1st, 2012
7:52 am
Yessir. That will be the right score MB.
HPDawg
December 1st, 2012
8:00 am
The Dawgs want it more and it will show,
the Tide will ebb, their fans will go,
back to their life without new bling,
for the Dawgs will this time will wear
THE RING!!!!!!!!
HPDawg
martin
December 1st, 2012
8:01 am
To hear Georgia fans talk you would think that THEY have won 2 National Championships in the last 3 years. The question for Georgia fans is which defense shows up on Saturday, the one that shut down Florida or the one that surrendered 44 points to Tennessee. Georgia has a very overrated defense and a quarterback that has not been able to win the big games. Georgia has a chance but they must play a flawless game without 10 plus penalties.
GT
December 1st, 2012
8:03 am
You don’t hear much about the coaching; it is all about the teams where Georgia is clearly the better talent. What separates these teams is Saban is a real football coach, Kirby Smart understudied and has become in one system the finest defensive coach in the country. And they don’t need Williams telling them they are soft, Alabama team don’t come soft ask Tommy Bowden who was caught asking Saban how he put such tough teams on the field. If Georgia could concentrate on the goal one quarter like Alabama does for four they would win this thing but they won’t get their heads into it until it is over.
HPDawg
December 1st, 2012
8:11 am
Nick is walking aroung this morning,
he can’t eat, his wife he’s scorning.
He’s been the king of Bama for years,
tonight his fans will leave in tears.
And Lord Saban will be left to despair,
for today the Dawgs will raise the
SEC HARDWARE!!
GO DAWGS! GATA!!
HPDawg
Brown Dog
December 1st, 2012
8:17 am
Good luck to both teams. If Alabama can run it, they win. If Georgia can run it, it will go to the wire.
Will said it .......
December 1st, 2012
8:17 am
” We had our shot” said Coach Muschmp. Florida beat SC like a rented mule and Florida whipped BOTH TX A&M and LSU.
This is the reality of the SEC.
To say that ” UGA did not play” so and so is as invalid as saying that UGA id not play Oregon or UCLA, or the real USC. UGA PLAYED THER SCHEDULE. THAT PUT THEN IN THE DOQME..
The haters are out in their old gold and white.
Go Dogs!!!
MunsonFan
December 1st, 2012
8:18 am
He can do it, I KNOW he can! Other bright spots for me this year, listening to these two guys who have (to me) shaken things up as well. These “JoJaBoys” that do this broadcast of the game, pretty dang funny and REALLY fun to listen to. http://JoJaboys.com I spreading their link b/c I want them to keep doing this
JB
December 1st, 2012
8:19 am
GT….. Was does no one bring up that Bama did not HAVE TO PLAY UGA,SC or FLA this year?
JB
December 1st, 2012
8:20 am
whoops……WHY does no one
Correction for very uneducated GT blogger
December 1st, 2012
8:22 am
SEC placed Missouri on the UGA schedule instead of Alabama.
UGA should remove GT from our schedule.
Go Dogs.
Truth
December 1st, 2012
8:22 am
@JB
Because everyone understands that the East Division is still the weak sister in the SEC.
Bamahere
December 1st, 2012
8:24 am
Get real dogs, this game will not even be close. We don’t see you every year so you are not as hated a rival as Auburn and LSU for us but you basically are a SEC B team. I would expect this game to be much like the S Carolina game for you, so just pull for us against N Dame so you at least will be able to say you are in a conference that won the NC. You sure are not going to.
What they’re saying in Georgia about Alabama’s SEC Championship Game opponent (game-day links) – Alabama – Crimson Tide News
December 1st, 2012
8:29 am
[...] AJC.com, the website of the Atlanta Journal-Constitution:* For Mark Richt and Georgia the moment is finally at hand* GAME DAY: Georgia-Alabama preview* Junkyard Blawg: Dawgs need a nearly perfect game to stem the [...]
DogFaceBlues
December 1st, 2012
8:42 am
Lets Get Ready to Rumble!
ARdawg
December 1st, 2012
8:44 am
It’s quite funny how you Tech haters are out en masse on the UGA blogs to spread you hate filled vitriol, today of all days. No matter what happens later today, j ust remember this, WE OWN THIS STATE! 42-10
ARdawg
December 1st, 2012
8:46 am
If UGA didn’t play Tech, our strength of schedule would be much stronger
Joey
December 1st, 2012
8:50 am
Truth, that is not so this season. Rank the teams in each division and check their records vs the other division. It has equaled out.
But don’t let facts get in the way of your “weak sister” BS.
Truth
December 1st, 2012
8:50 am
That’s pretty impressive — beating Tech.
Truth
December 1st, 2012
8:51 am
The East division won’t really be relevant again until Florida and Tennessee are back at full strength.
Joey
December 1st, 2012
8:59 am
It’s a hoot ARdawg, the whiners can’t shutup about UGA’s schedule – like it’s our fault UT, AU and GT are all crappy teams this season.
All I know is UF has the most impressive resume of any conference team, and the only game they lost all season was to us.
If Bama blows us out, I’ll agree that we didn’t belong.
But if Murray comes out and plays his game, and we protect him, it won’t the Dawgs who get lit up . . .
CEPH
December 1st, 2012
9:02 am
Richt said at the beginning of 2012 that this team is” knocking on the door of greatness” well it is time to stop knocking and open the damn door.. If he doesn’t win this game then we should open the door and kick him out of it!!!!!! This is his chance and if he doesn’t do it he ‘HE NEVER WILL’
Wet Willie...keep on smiling
December 1st, 2012
9:02 am
OK folks it is time to get serious bout dis stuff. I got my gameface on and talked mean to my wife’s maltese this AM on her walk! Best of luck and Roll Tide….
what about the number of fans that showed for Stanford and UCLA game last night??? Pitiful. There is a story there and it’s not about football. Enjoy the day and game for a whole bunch of teams would love to be in this game unlike the far west slackers (easy button crowd).
ARdawg
December 1st, 2012
9:06 am
Joey
I don’t see a blowout either way. It’s going to be a good game. I do believe we’ll have the upper hand based on our better QB. The haters can say what they will, Murray is a good QB and I suspect the world will see it today
Truth
December 1st, 2012
9:10 am
I agree that Georgia can’t help what their schedule is. Well… At least not their conference schedule.
Still, there is no doubt that Murray’s stats have been padded against inferior competition. If you only look at his performance in the few big games in which he’s played, he’s about the fourth or fifth best QB in the SEC.
Truth
December 1st, 2012
9:12 am
In Murray’s defense, he’s never had a quality O-line to play behind. Still doesn’t.
Joey
December 1st, 2012
9:16 am
Truth, so those SEC QBs you rank ahead of Murray didn’t play well against their cupcake opponents?
Come on.
I do agree about our O-line. They have to play even better than they did vs UF for us to have a chance.
Theoilchannel.com
December 1st, 2012
9:18 am
Go S E C !! Better Yet Go DAWG !! U.S.A. – U.S.A.
For Mark Richt and Georgia, the moment is finally at hand – Georgia – Dawg News
December 1st, 2012
9:18 am
[...] more here: For Mark Richt and Georgia, the moment is finally at hand ← Back to Home Tags: coach, division, finally, georgia, great, mark, moment, plan, [...]
Truth
December 1st, 2012
9:20 am
@Joey
Of course they played well against cupcakes, but they typically didn’t play the entire game. Georgia has no backup QB. The better quarterbacks also played well against quality opponents. Murray simply has not done that. That is the Truth©.
A RTR Hit-N-Run from ATL
December 1st, 2012
9:24 am
I know, you just couldn’t wait to hear from me. I’m headed down to the game now.
Just thought on gameday I should say something cordial, and I will. I will be greatly disappointed in Alabama if we win by anything less than 4 touchdowns.
AL 49 UGA 6
JustMe
December 1st, 2012
9:28 am
Hope the Dawgs win…..but I feel yet another disappointing big game performance. Richt, Bobo and Murray will be tighter than Dick’s Hat band…..
ARdawg
December 1st, 2012
9:30 am
RTR is headed down for a disappointment
Escaped from Email Purgatory
December 1st, 2012
9:30 am
Good luck to the Dawgs this afternoon. You gotta beat ‘Bama and the Bradley curse.
brenda
December 1st, 2012
9:37 am
uga went 1-1 against the only 2 teams worth a damn on their schedule. the win was BARELY a win and the loss was a beatdown.
just the facts
brenda
December 1st, 2012
9:40 am
truth wrote “he never had a good O line”
why is that? who is responsible for building one? is richt missing something in recruiting or coaching one up?
i understand if players had graduated but that should only be an excuse every 4 yrs or so.
then again, richt wanted Cam as a TE and not a QB
Truth
December 1st, 2012
9:48 am
Coach Richt is a very good coach. I understand that he’s also a really nice guy and a Lodge Brother. It is quite an accomplishment to play for the SEC Title — even if you don’t win it.
Steve
December 1st, 2012
9:48 am
Alabama 27 UGA 21, coming from a UGA fan. I hope I am wrong!
Truth
December 1st, 2012
9:51 am
@Steve
If Alabama shows up ready to play, then the score really shouldn’t be that close.
Steve
December 1st, 2012
9:56 am
Truth, don’t be one of those morons who say it’s going to be 45-3. Both teams are very good. Will be close either way.
Truth
December 1st, 2012
9:58 am
42 – 14
Ben
December 1st, 2012
9:59 am
Things are laid out for GA as good as they could hope for. Beat ALA, whose defense is weaker than past. Then having ND to beat instead of Oregon.
Steve
December 1st, 2012
10:15 am
Thanks for proving my point, Truth. Moron.
Truth
December 1st, 2012
10:20 am
I’ll be here this evening. We’ll see.
Stiffneck
December 1st, 2012
10:20 am
Dawgs are gonna shock the college football world today!! Bring it on. Go Dawgs!!!
Steve
December 1st, 2012
10:27 am
I won’t. I have a life and will be out with friends watching the game.
Truth
December 1st, 2012
10:27 am
My Internet goes with me. I gave up the dial up connection in the last decade.
Truth
December 1st, 2012
10:30 am
Seriously Steve, best of luck my friend.
You’ll need it. Georgia will, indeed, shock the CFB world if they win this game. It could happen. The best team usually wins, but not always.
Honey boy
December 1st, 2012
10:38 am
It’ll be closer than people think… I feel Bama is whistling past the graveyard here… They havent really played anyone but LSU… Pfft.. Texas A&M exposed them… They’re not invincible and certainly not the perfect football team the Tide drinkers would have you believe…
Dawgs win a squeaker 24-21 on a McCarron turnover late… Dawgs kick a late field goal late to break their hearts and let the excuses begin for the Dimson Pride… Bet the single wide!!!
Truth
December 1st, 2012
10:42 am
Kentucky.
Joey
December 1st, 2012
10:44 am
Oh no, Honey boy, I hope it doesn’t come down to a late FG – our boy is liable to kick it closer to the corner of the end zone than the up rights.
LSU 42, UGA 10
December 1st, 2012
10:48 am
Show me a reason why UGA will beat Alabama, and I’ll listen. Right now all you have is a UGA loud mouth player’s “we better in every position!”
But what evidence is there that UGA is better? I see Bama, National Championships, lost only 5 games in 4 seasons and beat a plethora of ranked teams many times in a blow out. I see experience, size, higher ranked recruits, proven coach.
Now lay out why UGA is better and I’ll list… read…
Truth
December 1st, 2012
10:51 am
Credit where due: Georgia has played better in the latter half of the season.
Against the likes of Auburn, Georgia Southern and Tech.
Tampa Gator
December 1st, 2012
11:17 am
Why is Georgia better…….
Florida beat Texas A&M……..Georgia beat Florida……..Texas A&M beat Bama. That is one REASON.
Another one…….Georgia has better players on defense……see above.
Another one…….Georgia has a more talented QB.
Another one…….Georgia’s RBs are just as good as Bama’s RBs….maybe better.
Another one…….Georgia WRs are as good as Bama’s…..maybe better.
Another one…….Georgia is a better pass rushing team than Bama.
Another one…….Georgia has better safeties….both to play in the NFL next year.
Another one…….Georgia….I believe….will be more motivated to win.
Bama has one major edge on the field……the OL….and that is the only edge.
But Georgia has the edge on the DL…….and that is a big edge.
Only negative……..Saban vs. Richt…..will Richt finally step up and coach well in a big game????….
Tampa Gator
December 1st, 2012
11:21 am
………and I think Florida will be playing Texas A&M in Atlanta next year…..
Tampa Gator
December 1st, 2012
11:25 am
Watching ESPN game day……..
And Fowler just said FSU was beating Florida until Manual fumbled…….like when…..a true freshmen LB….Morrison….knocked Manual into Nebraska….with him leaving the football behind. Truth…..they were leading Florida until the middle of the 3rd quarter….when Florida just took the game from them physically.
……..and did anyone see the story on Jarvis Jones this morning on Game Day…….wow…..much, much more respect for what Jarvis has done and overcome now. He could have gone another direction…..and he didn’t. He went in the opposite direction and has become a true man of character and achievement……and not just on the football field. Very inspiring story.
Joey
December 1st, 2012
11:30 am
Look techie (10:48), Rambo isn’t the only one saying that – lots of analysts are saying that Bama is deeper but UGA’s starters are as, or more talented than Bama’s. Their O-line is the big advantage, and it may be enough. But to act as if UGA has no chance in this game is silly.
But you go ahead and cling to that stupid, “last 4 seasons . . . .” crap – we will see in a few hours what ‘08 and ‘10 mean in this game. We’ll see how that works out for you
********************************************************
Hey Truth, why leave out UF, and even Ole Miss, who lost by 3 to A&M, and torched Auburn and Ark before we ended their run – badly – a little worse than Bama did actually. Ole Miss left here and came within seconds of beating LSU, yet you and your bunch like to rank UGA below LSU and A&M.
Something gets a little smelly with you guys – smells like jealously.
Y’all do come back after the game for a chat – I’ll stop by, win or lose.
Will y’all?
Truth
December 1st, 2012
11:32 am
Florida was lucky to play A&M early and to play LSU when their O-line was decimated — one week after they scratched by Auburn 12 – 10. Florida would defeat Georgia about 85% of the time if they played an infinite series of games, but the Gators aren’t really as good as their record implies.
Georgia was mutilated by SC and almost lost to Kentucky. A&M (good football team, BTW) caught Bama flat and got a quick 21 point lead. They still needed an improbable interception in the end-zone in the final seconds of the game to win.
Truth
December 1st, 2012
11:34 am
@Joey
I watched the Georgia vs. Ole Miss game. The only thing that Georgia could do against them was hit long passes. If Ole Miss hadn’t been so depleted from injuries in their secondary, it’s doubtful that Georgia would have won that game.
Joey
December 1st, 2012
11:36 am
Tampa, you think UF will give up a home game (A&M)? Could happen though, UF is gonna start next season ranked 1 or 2.
You are right about Jarvis – it is unbelievable how humble, mature, and team-oriented he is, and how much he has overcome. He deserves every bit of it.
I hope we get to see him for years to come on Sundays.
Pete
December 1st, 2012
11:38 am
Dawgs 24-Bama 17
Joey
December 1st, 2012
11:40 am
Truth (11:34), you went to sleep apparently. UGA got 533 total yards – 384 passing, and 149 rushing.
Keep spewing – you look rediculous . . .
ARdawg
December 1st, 2012
11:45 am
Better yet, why do you Tech trolls think anyone gives a fat rats patootie what you think?
WE OWN THIS STATE!!!
Truth
December 1st, 2012
11:50 am
UGA truly does dominate Georgia Tech.
Hey! That’s something…
ARdawg
December 1st, 2012
11:53 am
Truth = Techie with a bag on his head. Who could blame him?
Tampa Gator
December 1st, 2012
11:57 am
…..and Truth…..
They were lucky to play SC when they did…..and FSU when they did……….and….if Florida played A&M today…..they would win again because Florida’s defense is even better now….and the offense is a lot better now. I am not sure any team in the SEC would beat Florida right now….or anyone in the country for that matter. But the TRUTH is….Truth…..A&M does not get to play Florida right now…..and Florida does not get to play Georgia or Alabama right now.
danny
December 1st, 2012
12:10 pm
David Pollack is absolutely GUTLESS! Has turned into nothing but another ESPN pawn
Joey
December 1st, 2012
12:18 pm
“The only thing that Georgia could do against them was hit long passes.”
************************************************
Truth, UGA had 533 total yards, 384 passing (21 completions) and 149 yards rushing.
Keep trying, but you are looking ridiculous.
Joey
December 1st, 2012
12:20 pm
“The only thing that Georgia could do against them was hit long passes.”
************************************************
Truth, you musta fell asleep. Against Ole Miss, UGA has 533 total yards, 384 passing (21 completions) and 149 yards rushing.
Keep trying, but you are looking petty, and not very informed.
Dewnsav
December 1st, 2012
12:26 pm
personally I’m glad all the ESPN boys are picking Bama…means nothing to me…Bama favored by a touchdown so I can’t blame ‘em…they are like the weather man, 50/50 chance…the game will be played and hopefully the dogs will be the one left standing…we’ll see soon enough…go dogs
SSIgator
December 1st, 2012
12:28 pm
Joey -
Like reading your posts of late. Sounding much more rational and clear headed in your thoughts. If Alabama beats UGA like they are projected to then the focus will once more swing back to what has been wrong with this UGA picture for several years now – coaching. Another UGA meltdown today and maybe, finally, the UGA fans will recognize the limited skill set that the staff utilizes. If somehow UGA wins St. Markus Rectumus will be crowned a genius by the UGA Kool-Aid Club. Either way, it will be interesting.
Tide Rising
December 1st, 2012
12:33 pm
Danny,
David Pollack was asked his honest opinion and he gave it. His heart says Georgia. His head says Bama. A lot of Georgia fans seem to be of the same opinion.
Bottom line is that Georgia can win this game. But the only way they can win is if they use the same formula as LSU and Tam. 1- Aaron Murray is going to have to have the game of his life 2- UGA cannot turn the ball over at all against Bama 3- You’ve got to hope and pray Bama turns the ball over several times as we did against LSU and Tam. In other words your qb has to produce the best game of his life, your team has to play perfect, and you have to hope Bama makes uncharachteristic mistakes. Otherwise you have no chance.
SSIgator
December 1st, 2012
12:35 pm
Tide Rising -
Good luck to you guys today. Hopefully we will get to me in Atlanta a year from now.
Tide Rising
December 1st, 2012
12:38 pm
“Keep trying, but you are looking petty, and not very informed.”
Georgia played very well against Ole Miss. Much better than Bama or most other teams did. But so what? They had 5 common opponents if I remember correctly and Bama played better against 3 of the 5 than Georgia did.
And in the Ole Miss game Georgia just matched up very well with them. Ole Miss is very poor at pass defense(just ask Tejas) and Georgia is great passing against weak defenses.
UGA’s problem is when they have to pass against a great D like Florida or S. Carolina.
collegeballfan
December 1st, 2012
12:40 pm
If the UGA OL blocks Bama, UGA wins.
Tide Rising
December 1st, 2012
12:43 pm
SSIGator,
Thanks man. Gators are young. In the wayyy to early preseason projections for 2013 I would put UF at no 1 or in the top 3. I would even put them ahead of my guys. I gave up the faith when I picked FSU to beat UF but was damn happy when the gators came back and put it on them in the 4th in their own house.
BTW that’s a great point. Whether UGA wins or loses today it will be damn interesting to see the reaction of the dawg fanbase. In October they were ready to fire Richt’s ass and now they think he’s the 2nd coming. Will they be calling for his dismissal or annointing him as the greatest coach in UGA history or the world for that matter. Either way its going to be comical to watch the dawg fanbase reaction.
Florida Fans are Foolish-
December 1st, 2012
12:45 pm
Tampa Gator
December 1st, 2012
11:17 am
Why is Georgia better…….
Florida beat Texas A&M……..Georgia beat Florida……..Texas A&M beat Bama. That is one REASON. ( Probably the Dumbest of your Reasons)
Another one…….Georgia has better players on defense……see above. (Players are on thing, execution is primary and who do you think executes better?)
Another one…….Georgia has a more talented QB.( Being smart and a Proven Winner is more important)
Another one…….Georgia’s RBs are just as good as Bama’s RBs….maybe better.( Even-not better)
Another one…….Georgia WRs are as good as Bama’s…..maybe better.( Wrong and You are just spitting into the wind on that dumb reason.)
Another one…….Georgia is a better pass rushing team than Bama.( You dummy, Alabama has not “pass rushed” all season except on blitzes, Pay Attention Old Timer- they Pressure Rush by Zones, and that keeps running quarterbacks and dump offs)
Another one…….Georgia has better safeties….both to play in the NFL next year.( Those two safeties are also players who have issues with staying out of trouble, smoke dope, beat women, and commit common penalties)
Another one…….Georgia….I believe….will be more motivated to win.( Another really stupid reason)
Bama has one major edge on the field……the OL….and that is the only edge.( Linebackers,Tight Ends, OL, RB, WR, Coaching, Schemes, Experience, Strenght, Conditioning, Adjustments made during game,…..and on and on……what a toilet bowl statement from a guy who is absolutely clueless)
But Georgia has the edge on the DL…….and that is a big edge. ( You are retarded, Alabama is 8 deep on the DL, while UGA has 4 who are average)
Only negative……..Saban vs. Richt…..will Richt finally step up and coach well in a big game????….
Tampa Gator, you need to get new material, your logic is being flawed by your desire to make your precious gators look better if UGA wins, but wanting something and it being the truth is miles apart, just ask those sending letters to Santa Claus.
SSIgator
December 1st, 2012
12:50 pm
Such is the conundrum wrapped in an enigma that is the UGA fan base. It is like after they beat the Gators and liked to say how UF was so bad – until they realized that it was their only quality win and they better shut-up about it since they needed quality wins on their resume’.
00mpa L00mpa dawg
December 1st, 2012
12:56 pm
Murray will show up as a dwarf again in big time games. Bama will clean our clocks today. Mark Richt has always choked in the big ones.
Wet Willie...keep on smiling
December 1st, 2012
1:01 pm
Tampon Gator…if Bama needs anything out of you Gators we will beat it out of you! UGA just might win this game and win big if Bama makes some mistakes that we don’t normally make. Lot of good things have happened to the Dawgs this year and that just might be a story on how they finish. If Bama were to lose then we will just say congrats to UGA, get back on the bus and head back to T-town to start the process all over again for 2013. Play with class and let the other teams act the part of the azz! Roll Tide
Joey
December 1st, 2012
1:26 pm
Tide Rising, I wan’t bragging bout beating Ole Miss, I was responding to the “Truth” post that was, well, petty.
I suffer no illusions about today’s game – I know who SHOULD win – and all that “common opponent” stuff doesn’t matter a bit. All that matters today is, when Bama smacks UGA in the mouth, will UGA smack em back?
Individual matchups of players, as well as coaching adjustments will rule the day.
I am an admirer of Saban and Smart, but I hope today, Richt can find the right stuff to beat them.
Roy
December 1st, 2012
1:42 pm
Nobody CARES about GT football. LMAO….
Joey
December 1st, 2012
1:43 pm
“Either way its going to be comical to watch the dawg fanbase reaction.”
*************************************************
Nice, Tide Rising. Yuk it up. So Bama has the best staff money can buy. Y’all do. Congrats. Congrats, etc, etc, etc. But I bet your coach is not underestimating our coach. Know why?
Ole, laid-back Mark Richt has beaten a Nick Saban defending BCS Champ before – by the tune of 45-16 – look it up – LSU vs UGA (2004).
It ain’t like Richt hasn’t won some big games – he just hasn’t won many lately.
MAJOR DAWG
December 1st, 2012
1:46 pm
Live from Bagram, Afghanistan…HOW BOUT’ THEM DAWGS!!!! As I said prior to the FLA game on one of the AJC blogs…BELIEVE, BELIEVE, BELIEVE
Let’s go DAWG NATION…let’s show Bama and the Aggies what ‘The Home of the 12th DAWG” is all about!
GO DAWGS!!!!!!!!!!!!!!!!!!!!!!!!!
LASH LAROO
December 1st, 2012
1:47 pm
The outcome of today’s game will be determined by the Dog’s DEFENSE and how well Coach Grantham and his assistants have prepared them. If they play “lights out”, vicious gang tackling, bad azz football like they are capable of, UGA wins going away.
Tampa Gator
December 1st, 2012
1:59 pm
Here will be the two possible reactions from some of those irrational Dawg fans if Georgia wins or loses today….no matter the score.
1. If they win.
“Georgia is now on the top of of top tier teams and will dominate the SEC and the national picture for years to come. No other team has a chance. We only hope we can keep all the coaches on the greatest coaching staff in the history of college football.”
2. If they lose.
“This team just can’t win the big game with Richt as the head coach and Murray as the QB. We need to fire the entire coaching staff and hire Kirby Smart right now. So much talent and coaches so poorly. I am sick of it. Georgia will never win as long as Richt and his group of loser are coaching Georgia. Fire Richt now.”
Of course, the rational Dawg fans will realize what a great season they have had…..beating Florida, Georgia Tech, and playing in the SEC title game…..and having the opportunity to play for the right to play in the national title game. And they will also realize that they were in that position because of Richt and his coaching staff.
Outback Bowl
December 1st, 2012
2:01 pm
Come on down, Alabama! Happy to have you!
chase
December 1st, 2012
2:02 pm
Here is a video I cut for all the Dawg fans out there GATA
http://youtu.be/tMWjvDNSuZkur comments here
chase
December 1st, 2012
2:03 pm
Let me try this again and GOOOO DAWGS….the video is to Al Pacino’s Any Given Sunday speech! enjoy
Here is a video I cut for all the Dawg fans out there GATA
http://youtu.be/tMWjvDNSuZk
Tampa Gator
December 1st, 2012
2:06 pm
Wet Willie……
Alabama is 5 and 8 vs. Florida since Florida decided to start playing real college football by first hiring Spurrier in 1990. Again…..5 wins and 8 loses since 1990. Keep “beating it out of the Gators like that” like that. Too bad Florida does not play Bama in the regular season next year…..and I doubt Bama will have the opportunity to play Florida next year in Atlanta with A&M around to “beat it out of” you Tide.
ATLien
December 1st, 2012
2:09 pm
This is the biggest UGA game in my lifetime, my wife is an Alum and I’ve never seen her so giddy. I’ve been following UGA and supporting the team while being objective about their deficiencies both recently and in the past. However, Richt coach smart, coach aggressive. Leave it all out on the field.
Aaron Murray, rise above your history. Make the plays make the right reads and DON’T Turn it over.
Defense, play discipline, no stupid PF penalties, no missed assignments in gap protection
GO DAWGS!!!! FORWARD to MIAMI!!!
Rolando McClain
December 1st, 2012
2:12 pm
Hey! I got nothing to do this weekend! Can I play in this game? Heck, I might not have nothing to do for quite a few weekends, cuz in my mind I’m done with the Raiders and the NFL! Hey I need something to do on the wekeends.Guess I’ll find someone to fight and fire my gun!
Tampa Gator
December 1st, 2012
2:12 pm
Truth…..Wet Willie……here are the top 6 teams in the country right now….and either one could beat the other on even given Saturday…in no particular order:
LSU, Texas A&M, Alabama, South Carolina, Florida, Georgia.
Did you notice how many of those top 5 teams Florida beat this year……and that would be two more than Bama did…..and the loses are the same.
Tampa Gator
December 1st, 2012
2:14 pm
Time for a “hog” cruise along the beach…..but will be back in time for the game. Go Dawgs….today.
CMo
December 2nd, 2012
12:35 pm
Congrats to both teams for an amazing SEC championship game…There should be a rematch in Miami.
Roll Tide
Honey boy
December 2nd, 2012
10:35 pm
THOMAS BROWN WTFRU???
YOU HAVE ZERO ZERO ZERO CREDIBIILITY HERE!! YOU LOUD MOUTH SELF RIGHTEOUS POS!!!
YOU MAKE ME PUKE… ALL THAT BLUSTER AND WHEN BAMA BEAT US YOU DON’T EVEN
SHOW UP WITH YOUR GARBAGE STATS AND CONDESCENDING SHEEEITE ‘!!!
POSERS LIKE YOU ARE WORTHLESS SACKS OF HUMAN EXCREMENT!!
PISS OFF THIS BLOG FOREVER…