For Mark Richt and Georgia, the moment is finally at hand
Twelve years a Bulldog, Mark Richt's breakthrough chance comes Saturday. (AP photo by David Goldman)
Mark Richt apprenticed at Florida State when the Seminoles played for five national championships in eight seasons, and he came to Athens expecting more of the same. “That was the plan coming in,” he said Friday, “but it hasn’t happened yet.”
It could well happen Saturday. If Richt’s team wins the SEC championship game, the plan will have come to fruition. Twelve years Georgia’s coach, Richt has never been so close to playing for the BCS title. Twelve years Georgia’s coach, the path finally is clear.
A coach can never know when, or if, his moment will arrive. Richt had great early success – three division titles and two SEC championships in his first five years – and then he had rather less. We began to wonder if a fine career could ever bring the ultimate validation. Well, it’s there to be seized under the off-white roof of the Georgia Dome, there to be seized in the kind of game Richt has waited all his life to coach.
Beat Alabama, and Georgia will play Notre Dame for the national championship. “I don’t want to minimize the importance of the SEC (title),” said Richt, speaking at a media briefing, “but that (the BCS) does add a lot more juice.”
A program that went years without defeating an opponent of true consequence now gets its shot at the opponent of greatest consequence. Alabama is the gold standard of college football, and Bama is favored by a touchdown. But the feeling of those close to the Tide is that this is Nick Saban’s least imposing team of the past four – two of which have won national championships – and that Georgia is at least a match in talent.
There’s also this: A mighty wind has stationed itself at Georgia’s back. On Oct. 6, the Bulldogs lost at South Carolina 35-7, and no national-champion-to-be has ever lost by 28 points. But every week since has brought nothing but glad tidings to Georgia hearts. Consider:
- Oct. 13: The Bulldogs don’t play, but are buoyed by South Carolina’s loss at LSU.
- Oct. 20: The Bulldogs barely beat Kentucky, but the bigger news is that South Carolina has lost again, this time at Florida. Georgia has the opening it needs to win the Eastern Division.
- Oct. 27: The Bulldogs beat the hated Gators to move to the top of the SEC East.
- Nov. 3: The Bulldogs beat Ole Miss and then see Alabama, which some were suggesting was good enough to handle an NFL team, barely escape at LSU.
- Nov. 10: The Bulldogs beat Auburn to clinch the East in game that begins an hour after Texas A&M upsets Alabama in Tuscaloosa.
- Nov. 17: The Bulldogs beat Georgia Southern, and much later they watch as Kansas State, ranked No. 1 in the BCS standings, and Oregon, ranked No. 2, both lose. Georgia ascends to No. 3 the next day, rendering the SEC championship against No. 2 Alabama a BCS play-in.
- Nov. 24: The Bulldogs pound Georgia Tech like a kettledrum.
Over seven giddy weeks, Georgia grew from a puzzling aggregation into a powerful one. Said Richt: “We have a lot of momentum.”
A month ago, the Bulldogs didn’t figure to stand a chance against mighty Bama. Today they’re seen by most neutral observers as a live underdog with a real chance, and even those picking the Tide are doing it largely because of the Tide’s experience in games of such magnitude. But this is a younger Bama team, and true eminence could be a year away.
For Georgia, both gifted and seasoned, a grand opportunity is at hand – an opportunity denied this program since the Bulldogs faced Penn State on Jan. 1, 1983. It was Herschel Walker’s last night as an amateur, and for 30 years Bulldog Nation has waited, not entirely patiently, for another chance at another national title.
For those long-suffering fans, for a coach who once seemed to have run out of ideas, for a team that was routed in its first real test of 2012 … for everyone involved with Georgia football, the moment has arrived. One massive game against one formidable opponent, one Dawg day of deliverance. Georgia 27, Alabama 20.
By Mark Bradley
Tell us what you think about the site
Customer Care »
Vacation stops, manage subscriptions and more
AJC Services
Sections
Other Editions
Visitor Agreement | Privacy Statement
© 2013 The Atlanta Journal-Constitution
381 comments Add your comment
1969 Graduate
November 30th, 2012
6:49 pm
It’s all about how the teams play, and the coaches coach on Saturday.
I’ll be keeping my eyes on the nose guards and the OL. Usually you can tell a lot about what’s going to happen by watching these positions for the first few possessions. Not always, but usually.
I think both teams – if not the fans of both teams – have a great deal of respect for the abilities of their opponents. They should. These teams have both played well this year, and both have overcome a significant loss, and both have battled well in games they could have otherwise lost (LSU, Kentucky).
It should be a good game. I think it will go our way.
Go, Georgia Bulldawgs!
Cohutta Dawgman
November 30th, 2012
6:51 pm
Know why you can’t identify a body in Alabama. All of the DNA mtches and their ain’t no dental evidence.
Patched Tire On I-95 in Jacksonville
November 30th, 2012
6:53 pm
DC; Sammy; Columbus; Dizzy
Why do you have to continue to change your name
Joey
November 30th, 2012
6:53 pm
You look it up, Alphare (6:27), or just ask again every couple hours.
Look this up too, while you’re at it: has any team other than one EVER won half of a national championship in the Tangerine Bowl vs a 3 loss team?
Patched Tire On I-95 in Jacksonville
November 30th, 2012
6:55 pm
and ranked #17
heath
November 30th, 2012
6:55 pm
This is one of the worst written articles I’ve seen in a while. I understand your point, the information is there, and I respect your opinion. However, the syntax and just basic flow is awful.
Spanky
November 30th, 2012
6:57 pm
Good post, 69 Grad! ..and to all my fellow dawg brothers and sisters who have waited so long for this moment, IT IS FINALLY HERE!! We have stood by our dawgs, and have defended our loyalty (unlike other fans of a school who just hide behind the success of other teams)… How the heck am I supposed to sleep tonight?! LOL!! Go Dawgs!!
Patched Tire On I-95 in Jacksonville
November 30th, 2012
6:57 pm
What Team claims national Titles that are shared by multiple teams without having won 1 outright
Yea its The Ramblin Joke From North Ave
Joey
November 30th, 2012
6:57 pm
“Why do you have to continue to change your name”
*************************************
Don’t expect an answer, Patched Tire.
Anybody who writes this knows what an idiot everybody thinks he is: “Which Coach has coached in more BCS Championships? Richt 5, Saban 3.
WTH?
Joey
November 30th, 2012
7:00 pm
Heath, why don’t you rewrite Mark’s post and send it to him, with a bill for services rendered?
I’m sure he will rush payment . . .
Patched Tire On I-95 in Jacksonville
November 30th, 2012
7:01 pm
Joey
I guess Kirby Smart coached 2 National Titles along with Muschamp
Saban Never Sleeps
November 30th, 2012
7:02 pm
You leg humpers need to know that the more you dream, the deeper the despair. Hang around after the game for Ramma Jammer
Competing SEC factions stump for privilege of beating Notre Dame – SI.com | football.sportreports.tk
November 30th, 2012
7:04 pm
[...] play-in gameESPN (blog)Keys to victory for Alabama, Georgia in SEC championship gameNOLA.comFor Mark Richt and Georgia, the moment is finally at handAtlanta Journal Constitution (blog)Online Athens -Patch.com -Roll ‘Bama Rollall 573 [...]
Erk's quote just one more time men !!!
November 30th, 2012
7:08 pm
GATAGATAGATAGATAGATAGATAGATAGATAGATA andGATA SOME MORE!!!!!!
GO DAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWGS !!!!!!!!
Rabbit
November 30th, 2012
7:08 pm
I believe the dogs are talented enough to win, but if, for even a minute, they think they’re better, that they won’t have to have the face saving intensity Sean Williams inspired at Fla., the minute they start believing Mark Bradley, it’s over.
I think the Dogs can win. I want them to. But they will walk onto a field against a team that will hit them hard and bring a strong desire to win and bring a history. Larry would say, “Hunker down, dogs.”
Saban Never Sleeps
November 30th, 2012
7:08 pm
Mark Bradley – have you gone absolutely nuts?? You are picking the leg humpers 27-20? Good god man, get to the hospital quickly as there still may be time to save you!!! Bama is going to take the ball and ram it down the leg humpers throats. Bama 34 Leg humpers 13
Joey
November 30th, 2012
7:09 pm
He does occasionally find some good stats, Patched, but then stuffs the the majority of his post with total BS.
What do you think about tomorrow? Think Richt is up to it?
Patched Tire On I-95 in Jacksonville
November 30th, 2012
7:11 pm
You would think that with all the upsets that have occured in the history of sports you would think fans would learn not to talk trash until after the game has been played
If Bama wins tomorrow the insurance companies will breath a sigh of relief because they wont have to pay out damages to Mobile Homes being destroyed due to a loss
#1bamafan
November 30th, 2012
7:13 pm
Only one thing left to say now…..RTR, the time is near.
Patched Tire On I-95 in Jacksonville
November 30th, 2012
7:17 pm
Joey
I hope Richt is up to it; I will be disappointed if they come out and call conservative plays like they did last year against Boise
I want to see Richt lay it all out
I know if I was in his position what do you have to lose; If he loses he will forever be branded a coach like Beamer that cant win the big game; if he wins UGA and Richt will start to get the respect that is deserved
Saban Never Sleeps
November 30th, 2012
7:18 pm
Amen #1Bamafan
Joey
November 30th, 2012
7:19 pm
Amen.
I hope he does it.
Cousin Curtis
November 30th, 2012
7:20 pm
Bama 31
Dawgs 21
georgianabulltiger
November 30th, 2012
7:20 pm
So, I read today that the New Orleans Roll Tide Pride Teabagger is going to get 2 years, serve 11 mos. You just have to admire Alabama football for all they’ve accomplished in the last few years, while at the same time navigating your way around Bama football fans:
http://sportsillustrated.cnn.com/2012/football/ncaa/10/02/alabama-lsu-bcs-video.ap/index.html#ixzz28Eq8932h
Under The Bleachers
November 30th, 2012
7:23 pm
Just want to say first. Good Luck to UGA, no matter who wins( I am hoping Alabama) I will be the biggest fan of the winner against Notre Dame in January.
I think UGA has a great team,especially on defense. They have earned their right to play in the game while others fell.
Now the part where I may make UGA fans mad, but they are just opinions, Since the UF game in which the CBS TV crew called “horrible to watch” many of the UGA fans have gotten all up about how good UGA is after playing teams that were for the most part average to less than average. I know I know, the same can be said about Alabama, but after UGA fell behind 21-0 early against USC we saw a teams efforts not live up to that level when things went bad. Alabama fell behind 20-0 and came back but still lost on the last minute interception. This is going to be a good game, I hope just to show the rest of the nation how Conference Championship games are played at the Big Boy level. But I just see UGA folding again if they get behind by more than 2 scores in the second half.
Once again Good Luck Dawg Fans!
The Nature Boy
November 30th, 2012
7:24 pm
Roll Tide Roll..right down the toilet and into the bowl…….Lou Holtz picked the dawgs…and I puked in the toilet bowl…..GO DAWGS!!!!
Wet Willie...keep on smiling
November 30th, 2012
7:29 pm
I am an old guy and have been apart of the Coach Bryant great years but like most younguns we thought they would never end and if we didn’t win the NC each year then we failed! As the years rolled by you then start(should) understand just how much work and much luck it takes to WIN JUST 1 NC. Last years NC for Bama was just amazing in that the luck we had with everybody getting beat in order for us to get into the game. The blasting of LSU was sweet no doubt and that NC was the cool whip on the apple pie for me. Not sure I will ever see Bama win another but if not then that is fine for we’ve had a plenty in my lifetime. I hate to see that many fans believe their team has failed when they finish at 10-2,11-1 and a nice bowl game. It takes a great coaching,playing,injury luck, and schedule luck to get that glass bowl and that doesn’t always fall your way. Lot of you good folks slam Nick Saban and often and 99% of you know nothing of the man and that is sad. I can tell you first hand Nick understands he is not the smartest coach (person) in football and his deep belief is he has to outwork any and all to have success. He will be beat but nobody will ever outwork the guy and at his age that is saying a bunch. 24/7/365 is all football and most other things are clutter. Best of luck and Roll Tide.
Saban Never Sleeps
November 30th, 2012
7:30 pm
Nature Boy, Lou picked the leg humpers because he knows Bama will destroy his beloved Irish. Bring your best tomorrow. make sure your pads are strapped a little tighter because there will be some hitting.
kingdaddy
November 30th, 2012
7:31 pm
You guys play nice tonight. Where’s all the douchebag nerds oretending to be Bama fans???
bob
November 30th, 2012
7:32 pm
Ga did beat Fla by a hair.Who else? Thier division is soooo weak.If they played the other division schedule,they would not be a top 10.
Vampire Bill
November 30th, 2012
7:34 pm
Either dawgs by 3 (yah) or bammer by 21
Discount DoubleDawg
November 30th, 2012
7:35 pm
bob- You might be right but if Georgia wins tomorrow you are wrong… we will just have to wait and see. Most think Georgia has a good shot.
Patched Tire On I-95 in Jacksonville
November 30th, 2012
7:39 pm
Saban Never Sleeps
Thanks for the advice
I would also like to add please make sure your house on wheels is tied up to the back of your rusty mid 70’s model pick up truck on your way to the game
oh and please try not to litter your beer cans and chew spit in our beautiful state
Atlanta hosts SEC’s play-in game – ESPN (blog) | football.sportreports.tk
November 30th, 2012
7:42 pm
[...] Post (blog)Keys to victory for Alabama, Georgia in SEC championship gameNOLA.comSun-Sentinel -Atlanta Journal Constitution (blog) -USA TODAYall 584 news articles » http://news.google.com [...]
Paul Finebum
November 30th, 2012
7:46 pm
I WILL GROW HAIR IF UGA WINS!
kingdaddy
November 30th, 2012
7:48 pm
I must be tired, I have nothing to say. Probably a good thing…
Paul Finebum
November 30th, 2012
7:50 pm
I WILL GET MY EARS PIERCED !
Jimmy Crack
November 30th, 2012
7:52 pm
How could anyone tell what Lou Holtz says?
Paul Finebum
November 30th, 2012
7:54 pm
HEY NATURE BOY,DID YOU HAVE TO WALK OUTSIDE TO GET TO IT?
The Nature Boy
November 30th, 2012
7:24 pm
Roll Tide Roll..right down the toilet and into the bowl…….Lou Holtz picked the dawgs…and I puked in the toilet bowl…..GO DAWGS!!!!
Myst
November 30th, 2012
7:57 pm
Mark Richt has coached in 3 National Title games:
1998, 1999, 2000
Mark Richt’s offense at FSU was prolific enbough to get FSU into the National Championship 3 years in a row.
Nick Saban will never match that.
Danny Ford
November 30th, 2012
8:00 pm
Georgia coming in third place is not bad for a coach & staff that everyone wanted fired last year.
A look at the 76th day of the NHL lockout – Washington Post
November 30th, 2012
8:02 pm
[...] of beating Notre DameSI.comPredicting Alabama vs. GeorgiaHuffington Post (blog)Sun-Sentinel -Atlanta Journal Constitution (blog) -Times-Journalall 596 news [...]
The Nature Boy
November 30th, 2012
8:03 pm
we got indoor plumbing…but when I turn the water on I hear a whistling noise…(air in the pipes..??) cant afford a plumber…but there is plenty of bud ice in the fridge…..GO DAWGS!!
dawgs25
November 30th, 2012
8:06 pm
at bob………………..who did Alabama beat?
Patched Tire On I-95 in Jacksonville
November 30th, 2012
8:06 pm
Sammy; Dizzy; Columbus DC now I see its Myst
Bobby Bowden was the head coach of those teams not Richt
Rick in Warner Robins
November 30th, 2012
8:07 pm
I don’t know how anyone believes UGA has half a chance against Bama. UGA is not in the same league as Bama…beating all these mediocre, barely middle school teams is going to show tomorrow…UGA fans will be boo-hooing all the way home. Poor little bull dawgies…
Bama by at least 20.
The Nature Boy
November 30th, 2012
8:07 pm
Danny Ford is so crooked that I cant figure out how he puts his pants on……
dawgs25
November 30th, 2012
8:08 pm
at bob ………….who did alabama beat………………..georgia beat the then #2 team in the country……….what is the highest ranked team at the time of the game that alabama beat……..oh and by the by …………florida is ranked #4 now………and where is the best team that alabama ranked now???
Nothing wrong with Georgia’s and Alabama’s differing pre-game mentalities … – al.com | football.sportreports.tk
November 30th, 2012
8:10 pm
[...] of beating Notre DameSI.comPredicting Alabama vs. GeorgiaHuffington Post (blog)Sun-Sentinel -Atlanta Journal Constitution (blog) -USA TODAYall 597 news articles » http://news.google.com [...]
Danny Ford
November 30th, 2012
8:12 pm
Watch it!